Human AQP8(Aquaporin 8) ELISA Kit


Notice: Trying to access array offset on value of type bool in /home/fwsoeulh/domains/micca.org/public_html/wp-content/plugins/gentaur-linking/app/Libs/LSPDRequest.php on line 194

Notice: Trying to access array offset on value of type bool in /home/fwsoeulh/domains/micca.org/public_html/wp-content/plugins/gentaur-linking/app/Libs/LSPDRequest.php on line 208

Notice: Trying to access array offset on value of type bool in /home/fwsoeulh/domains/micca.org/public_html/wp-content/plugins/gentaur-linking/app/Libs/LSPDRequest.php on line 229

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/micca.org/public_html/wp-content/plugins/gentaur-linking/vendor_prefixed/pwpf/src/View/View.php on line 103

Human AQP8(Aquaporin 8) ELISA Kit


Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/micca.org/public_html/wp-content/plugins/gentaur-linking/vendor_prefixed/pwpf/src/View/View.php on line 64

Human Aquaporin 8 (AQP8) ELISA Kit

RD-AQP8-Hu-48Tests 48 Tests
EUR 521

Human Aquaporin 8 (AQP8) ELISA Kit

RD-AQP8-Hu-96Tests 96 Tests
EUR 723

Human Aquaporin 8 (AQP8) ELISA Kit

RDR-AQP8-Hu-48Tests 48 Tests
EUR 544

Human Aquaporin 8 (AQP8) ELISA Kit

RDR-AQP8-Hu-96Tests 96 Tests
EUR 756

Human Aquaporin 8 (AQP8) ELISA Kit

abx572448-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Human Aquaporin-8(AQP8) ELISA kit

E01A1618-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Aquaporin-8(AQP8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aquaporin-8(AQP8) ELISA kit

E01A1618-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Aquaporin-8(AQP8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aquaporin-8(AQP8) ELISA kit

E01A1618-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Aquaporin-8(AQP8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aquaporin- 8, AQP8 ELISA KIT

ELI-49092h 96 Tests
EUR 824

Human Aquaporin 8 (AQP8) ELISA Kit

20-abx150732
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Aquaporin 8 (AQP8) ELISA Kit

SED031Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Aquaporin 8 (AQP8) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Aquaporin 8 (AQP8) in Tissue homogenates, cell lysates and other biological fluids.

Human Aquaporin 8 (AQP8) ELISA Kit

SED031Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Aquaporin 8 (AQP8) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Aquaporin 8 (AQP8) in Tissue homogenates, cell lysates and other biological fluids.

Human Aquaporin 8 (AQP8) ELISA Kit

SED031Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Aquaporin 8 (AQP8) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Aquaporin 8 (AQP8) in Tissue homogenates, cell lysates and other biological fluids.

Human Aquaporin 8 (AQP8) ELISA Kit

SED031Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Aquaporin 8 (AQP8) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Aquaporin 8 (AQP8) in Tissue homogenates, cell lysates and other biological fluids.

Human Aquaporin 8 (AQP8) ELISA Kit

4-SED031Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Aquaporin 8 elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Aquaporin 8 (AQP8) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Aquaporin 8(AQP8)ELISA Kit

QY-E01452 96T
EUR 361

Aquaporin 8 (AQP8) Antibody

20-abx123590
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Aquaporin 8 (AQP8) Antibody

20-abx130491
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Aquaporin 8 (AQP8) Antibody

20-abx339081
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Aquaporin 8 (AQP8) Antibody

20-abx339090
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Aquaporin 8 (AQP8) Antibody

20-abx171307
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Recombinant Aquaporin 8 (AQP8)

4-RPD031Hu01
  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O94778
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 40.3kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Aquaporin 8 expressed in: E.coli

Goat Aquaporin-8(AQP8) ELISA kit

E06A1618-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Aquaporin-8(AQP8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Aquaporin-8(AQP8) ELISA kit

E06A1618-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Aquaporin-8(AQP8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Aquaporin-8(AQP8) ELISA kit

E06A1618-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Aquaporin-8(AQP8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Aquaporin-8(AQP8) ELISA kit

E03A1618-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Aquaporin-8(AQP8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Aquaporin-8(AQP8) ELISA kit

E03A1618-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Aquaporin-8(AQP8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Aquaporin-8(AQP8) ELISA kit

E03A1618-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Aquaporin-8(AQP8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Aquaporin-8(AQP8) ELISA kit

E04A1618-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Aquaporin-8(AQP8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Aquaporin-8(AQP8) ELISA kit

E04A1618-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Aquaporin-8(AQP8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Aquaporin-8(AQP8) ELISA kit

E04A1618-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Aquaporin-8(AQP8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Aquaporin-8(AQP8) ELISA kit

E02A1618-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Aquaporin-8(AQP8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Aquaporin-8(AQP8) ELISA kit

E02A1618-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Aquaporin-8(AQP8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Aquaporin-8(AQP8) ELISA kit

E02A1618-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Aquaporin-8(AQP8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Aquaporin-8(AQP8) ELISA kit

E07A1618-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Aquaporin-8(AQP8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Aquaporin-8(AQP8) ELISA kit

E07A1618-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Aquaporin-8(AQP8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Aquaporin-8(AQP8) ELISA kit

E07A1618-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Aquaporin-8(AQP8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Aquaporin-8(AQP8) ELISA kit

E09A1618-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Aquaporin-8(AQP8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Aquaporin-8(AQP8) ELISA kit

E09A1618-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Aquaporin-8(AQP8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Aquaporin-8(AQP8) ELISA kit

E09A1618-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Aquaporin-8(AQP8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Aquaporin-8(AQP8) ELISA kit

E08A1618-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Aquaporin-8(AQP8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Aquaporin-8(AQP8) ELISA kit

E08A1618-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Aquaporin-8(AQP8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Aquaporin-8(AQP8) ELISA kit

E08A1618-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Aquaporin-8(AQP8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Aquaporin- 8, Aqp8 ELISA KIT

ELI-23890m 96 Tests
EUR 865

ELISA kit for Human AQP8 (Aquaporin 8)

ELK3346 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Aquaporin 8 (AQP8). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Aquaporin 8 (AQ
  • Show more
Description: A sandwich ELISA kit for detection of Aquaporin 8 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Aquaporin 8 (AQP8) Protein

20-abx650276
  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Aquaporin 8 (AQP8) CLIA Kit

20-abx494057
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Guinea pig Aquaporin-8(AQP8) ELISA kit

E05A1618-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Aquaporin-8(AQP8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Aquaporin-8(AQP8) ELISA kit

E05A1618-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Aquaporin-8(AQP8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Aquaporin-8(AQP8) ELISA kit

E05A1618-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Aquaporin-8(AQP8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Anti-Aquaporin 8/AQP8 Antibody

PA1511 100ug/vial
EUR 294

Aquaporin 8 (AQP8) Polyclonal Antibody (Human)

4-PAD031Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AQP8 (Lys129~Trp228)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Aquaporin 8 (AQP8)

Aquaporin 8 (AQP8) Polyclonal Antibody (Human), APC

4-PAD031Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AQP8 (Lys129~Trp228)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Aquaporin 8 (AQP8). This antibody is labeled with APC.

Aquaporin 8 (AQP8) Polyclonal Antibody (Human), Biotinylated

4-PAD031Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AQP8 (Lys129~Trp228)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Aquaporin 8 (AQP8). This antibody is labeled with Biotin.

Aquaporin 8 (AQP8) Polyclonal Antibody (Human), Cy3

4-PAD031Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AQP8 (Lys129~Trp228)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Aquaporin 8 (AQP8). This antibody is labeled with Cy3.

Aquaporin 8 (AQP8) Polyclonal Antibody (Human), FITC

4-PAD031Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AQP8 (Lys129~Trp228)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Aquaporin 8 (AQP8). This antibody is labeled with FITC.

Aquaporin 8 (AQP8) Polyclonal Antibody (Human), HRP

4-PAD031Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AQP8 (Lys129~Trp228)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Aquaporin 8 (AQP8). This antibody is labeled with HRP.

Aquaporin 8 (AQP8) Polyclonal Antibody (Human), PE

4-PAD031Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AQP8 (Lys129~Trp228)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Aquaporin 8 (AQP8). This antibody is labeled with PE.

Aquaporin 8 (AQP8) Polyclonal Antibody (Human), APC-Cy7

4-PAD031Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AQP8 (Lys129~Trp228)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Aquaporin 8 (AQP8). This antibody is labeled with APC-Cy7.

Rat Aquaporin 8 (AQP8) Control/blocking peptide #1

AQP81-P 100 ug
EUR 164

Rabbit Anti-Rat Aquaporin 8 (AQP8) Antiserum # 1

AQP81-S 100 ul
EUR 457

Rat Aquaporin 8 (AQP8) Control/blocking peptide # 2

AQP82-P 100 ug
EUR 164

Chicken anti-Rat Aquaporin 8 (AQP8) Antiserum # 2

AQP82-S 100 ul
EUR 457

Monoclonal AQP8 / Aquaporin 8 Antibody (clone 1F8), Clone: 1F8

APG01968G 0.05mg
EUR 528
Description: A Monoclonal antibody against Human AQP8 / Aquaporin 8 (clone 1F8). The antibodies are raised in Mouse and are from clone 1F8. This antibody is applicable in WB and IHC-P, E

Rabbit Anti-Rat Aquaporin 8 (AQP8) IgG # 1, aff pure

AQP81-A 100 ug
EUR 482

Aqp8/ Rat Aqp8 ELISA Kit

ELI-34512r 96 Tests
EUR 886

1730 8 SNAP-SEAL 8 OZ

1730-8 100/pk
EUR 74
Description: Disposable Plastic; Plastic Containers

Human IL-8 Recombinant Protein

R00423-8 5ug/vial
EUR 259
Description: Interleukin-8 (IL-8), also known as CXCL8, is an ELR-positive CXC family member chemokine produced by macrophages and other cell types such as epithelial cells. ELR-positive CXC chemokines such as IL-8 specifically induce the migration of neutrophils, and interact with chemokine receptors CXCR1 and CXCR2. Human IL-8 Recombinant Protein is purified interleukin-8 produced in yeast.

8-Hydroxydeoxyguanosine (8-OHdG) ELISA Kit

DLR-8-OHdG-Ge-48T 48T
EUR 469
  • Should the 8-Hydroxydeoxyguanosine (8-OHdG) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of 8-Hydroxydeoxyguanosine (8-OHdG) in samples from serum, plasma or other biological fluids.

8-Hydroxydeoxyguanosine (8-OHdG) ELISA Kit

DLR-8-OHdG-Ge-96T 96T
EUR 608
  • Should the 8-Hydroxydeoxyguanosine (8-OHdG) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of 8-Hydroxydeoxyguanosine (8-OHdG) in samples from serum, plasma or other biological fluids.

AQP8 ELISA Kit (Human) (OKCD00891)

OKCD00891 96 Wells
EUR 831
Description: Description of target: Forms a water-specific channel; mercury-sensitive. Not permeable to glycerol or urea. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.113 ng/mL

General 8-Hydroxydeoxyguanosine (8-OHdG) ELISA Kit

RD-8-OHdG-Ge-48Tests 48 Tests
EUR 467

General 8-Hydroxydeoxyguanosine (8-OHdG) ELISA Kit

RD-8-OHdG-Ge-96Tests 96 Tests
EUR 646

General 8-Hydroxydeoxyguanosine (8-OHdG) ELISA Kit

RDR-8-OHdG-Ge-48Tests 48 Tests
EUR 488

General 8-Hydroxydeoxyguanosine (8-OHdG) ELISA Kit

RDR-8-OHdG-Ge-96Tests 96 Tests
EUR 676

Individual Reaction Mix 8

G065-8 200 reactions
EUR 167

Anti-Aquaporin 8 Antibody

STJ500144 100 µg
EUR 476

Anti-Aquaporin 8 (1F8)

YF-MA10052 100 ug
EUR 363
Description: Mouse monoclonal to Aquaporin 8

Anti-Aquaporin 8 Antibody BIOTIN

STJ500145 100 µg
EUR 586

Anti-Aquaporin 8 Antibody FITC

STJ500146 100 µg
EUR 586

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

AQP8 siRNA

20-abx900394
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

AQP8 siRNA

20-abx907899
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

AQP8 siRNA

20-abx907900
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

AQP8 Antibody

ABD9224 100 ug
EUR 438

AQP8 Antibody

36812-100ul 100ul
EUR 252

AQP8 antibody

70R-14050 100 ug
EUR 322
Description: Affinity purified Rabbit polyclonal AQP8 antibody

AQP8 Antibody

DF9224 200ul
EUR 304
Description: AQP8 Antibody detects endogenous levels of total AQP8.

AQP8 Antibody

1-CSB-PA905788
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against AQP8. Recognizes AQP8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:10000, IHC:1:25-1:100

AQP8 Antibody

1-CSB-PA186529
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against AQP8. Recognizes AQP8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:10000, IHC:1:50-1:200

General 8-Epi Prostaglandin F2 Alpha (8-epi-PGF2a) ELISA Kit

RD-8-epi-PGF2a-Ge-48Tests 48 Tests
EUR 467

General 8-Epi Prostaglandin F2 Alpha (8-epi-PGF2a) ELISA Kit

RD-8-epi-PGF2a-Ge-96Tests 96 Tests
EUR 646

PSA (Prostate-specific antigen) ELISA test

8 96T/Box Ask for price
  • Area of application: Hormone testing
Description: ELISA based test for quantitative detection of PSA (Prostate-specific antigen)

Human Aquaporin 0 ELISA kit

E01A0862-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Aquaporin 0 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aquaporin 0 ELISA kit

E01A0862-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Aquaporin 0 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aquaporin 0 ELISA kit

E01A0862-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Aquaporin 0 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aquaporin 1 ELISA kit

E01A0863-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Aquaporin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aquaporin 1 ELISA kit

E01A0863-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Aquaporin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aquaporin 1 ELISA kit

E01A0863-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Aquaporin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aquaporin 5 ELISA kit

E01A0870-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Aquaporin 5 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aquaporin 5 ELISA kit

E01A0870-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Aquaporin 5 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aquaporin 5 ELISA kit

E01A0870-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Aquaporin 5 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aquaporin 4 ELISA kit

E01A0467-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Aquaporin 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aquaporin 4 ELISA kit

E01A0467-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Aquaporin 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aquaporin 4 ELISA kit

E01A0467-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Aquaporin 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aquaporin 9 ELISA kit

E01A0469-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Aquaporin 9 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aquaporin 9 ELISA kit

E01A0469-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Aquaporin 9 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aquaporin 9 ELISA kit

E01A0469-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Aquaporin 9 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Chicken Anti Aquaporin 8 Polyclonal Antibody

CPBT-67908CA 50 µg
EUR 1157

Human AQP8 shRNA Plasmid

20-abx950241
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

AQP8 Recombinant Protein (Human)

RP001657 100 ug Ask for price

0.5-10UL 8-CHANNEL, DIGITAL PIPETTOR

AP-8-10 1/pk
EUR 425
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

20-200UL 8-CHANNEL, DIGITAL PIPETTOR

AP-8-200 1/pk
EUR 425
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

50-300UL 8-CHANNEL, DIGITAL PIPETTOR

AP-8-300 1/pk
EUR 425
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

5-50UL 8-CHANNEL, DIGITAL PIPETTOR

AP-8-50 1/pk
EUR 425
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

AQP8 Conjugated Antibody

C36812 100ul
EUR 397

AQP8 Polyclonal Antibody

ES9402-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against AQP8 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

AQP8 Polyclonal Antibody

ES9402-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against AQP8 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

AQP8 Polyclonal Antibody

ABP57800-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human AQP8 protein at amino acid sequence of 70-150
  • Applications tips:
Description: A polyclonal antibody for detection of AQP8 from Human, Mouse, Rat. This AQP8 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human AQP8 protein at amino acid sequence of 70-150

AQP8 Polyclonal Antibody

ABP57800-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human AQP8 protein at amino acid sequence of 70-150
  • Applications tips:
Description: A polyclonal antibody for detection of AQP8 from Human, Mouse, Rat. This AQP8 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human AQP8 protein at amino acid sequence of 70-150

AQP8 Polyclonal Antibody

ABP57800-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human AQP8 protein at amino acid sequence of 70-150
  • Applications tips:
Description: A polyclonal antibody for detection of AQP8 from Human, Mouse, Rat. This AQP8 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human AQP8 protein at amino acid sequence of 70-150

AQP8 Rabbit pAb

A8539-100ul 100 ul
EUR 308

AQP8 Rabbit pAb

A8539-200ul 200 ul
EUR 459

AQP8 Rabbit pAb

A8539-20ul 20 ul
EUR 183

AQP8 Rabbit pAb

A8539-50ul 50 ul
EUR 223

AQP8 Blocking Peptide

DF9224-BP 1mg
EUR 195

AQP8 cloning plasmid

CSB-CL001972HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 768
  • Sequence: atgtgtgagcctgaatttggcaatgacaaggccagggagccgagcgtgggtggcaggtggcgagtgtcctggtacgaacggtttgtgcagccatgtctggtcgaactgctgggctctgctctcttcatcttcatcgggtgcctgtcggtcattgagaatgggacggacactgggct
  • Show more
Description: A cloning plasmid for the AQP8 gene.

Anti-AQP8 antibody

STJ111278 100 µl
EUR 277
Description: Aquaporin 8 (AQP8) is a water channel protein. Aquaporins are a family of small integral membrane proteins related to the major intrinsic protein (MIP or AQP0). Aquaporin 8 mRNA is found in pancreas and colon but not other tissues.

Anti-AQP8 antibody

STJ190560 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to AQP8

pAAV-DJ/8 Vector

VPK-420-DJ-8 10 µg
EUR 647
Description: The pAAV-DJ/8 vector contains the rep and cap genes required to generated recombinant AAV of serotype DJ/8. Co-transfect with other packaging plasmids and an expression vector into 293 cells for AAV-DJ/8 packaging.

Human Aquaporin 5 (AQP5) ELISA Kit

CEA583Hu-10x96wellstestplate 10x96-wells test plate
EUR 4273.35
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Aquaporin 5 (AQP5) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Aquaporin 5 (AQP5) in serum, plasma, saliva, tissue homogenates, cell lysates and other biological fluids.

Human Aquaporin 5 (AQP5) ELISA Kit

CEA583Hu-1x48wellstestplate 1x48-wells test plate
EUR 439.57
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Aquaporin 5 (AQP5) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Aquaporin 5 (AQP5) in serum, plasma, saliva, tissue homogenates, cell lysates and other biological fluids.

Human Aquaporin 5 (AQP5) ELISA Kit

CEA583Hu-1x96wellstestplate 1x96-wells test plate
EUR 585.1
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Aquaporin 5 (AQP5) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Aquaporin 5 (AQP5) in serum, plasma, saliva, tissue homogenates, cell lysates and other biological fluids.

Human Aquaporin 5 (AQP5) ELISA Kit

CEA583Hu-5x96wellstestplate 5x96-wells test plate
EUR 2332.95
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Aquaporin 5 (AQP5) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Aquaporin 5 (AQP5) in serum, plasma, saliva, tissue homogenates, cell lysates and other biological fluids.

Human Aquaporin 5 (AQP5) ELISA Kit

4-CEA583Hu
  • EUR 4324.00
  • EUR 2283.00
  • EUR 586.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Aquaporin 5 elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Human Aquaporin 5 (AQP5) in samples from serum, plasma, saliva, tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Aquaporin 9 (AQP9) ELISA Kit

abx570057-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Aquaporin 4 (AQP4) ELISA Kit

abx513406-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Aquaporin 10 (AQP10) ELISA Kit

20-abx585384
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Aquaporin 1 (AQP1) ELISA Kit

abx571957-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Aquaporin 2 (AQP2) ELISA Kit

abx571980-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Aquaporin 3 (AQP3) ELISA Kit

abx571985-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Aquaporin 5 (AQP5) ELISA Kit

abx571988-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Aquaporin 4 (AQP4) ELISA Kit

abx573238-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Human Aquaporin-10(AQP10) ELISA kit

E01A1612-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Aquaporin-10(AQP10) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aquaporin-10(AQP10) ELISA kit

E01A1612-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Aquaporin-10(AQP10) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aquaporin-10(AQP10) ELISA kit

E01A1612-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Aquaporin-10(AQP10) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aquaporin-11(AQP11) ELISA kit

E01A1613-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Aquaporin-11(AQP11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aquaporin-11(AQP11) ELISA kit

E01A1613-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Aquaporin-11(AQP11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aquaporin-11(AQP11) ELISA kit

E01A1613-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Aquaporin-11(AQP11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aquaporin-12A(AQP12A) ELISA kit

E01A1614-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Aquaporin-12A(AQP12A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aquaporin-12A(AQP12A) ELISA kit

E01A1614-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Aquaporin-12A(AQP12A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aquaporin-12A(AQP12A) ELISA kit

E01A1614-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Aquaporin-12A(AQP12A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aquaporin-12B(AQP12B) ELISA kit

E01A1615-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Aquaporin-12B(AQP12B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aquaporin-12B(AQP12B) ELISA kit

E01A1615-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Aquaporin-12B(AQP12B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aquaporin-12B(AQP12B) ELISA kit

E01A1615-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Aquaporin-12B(AQP12B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aquaporin-6(AQP6) ELISA kit

E01A1616-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Aquaporin-6(AQP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aquaporin-6(AQP6) ELISA kit

E01A1616-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Aquaporin-6(AQP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aquaporin-6(AQP6) ELISA kit

E01A1616-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Aquaporin-6(AQP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aquaporin-7(AQP7) ELISA kit

E01A1617-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Aquaporin-7(AQP7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aquaporin-7(AQP7) ELISA kit

E01A1617-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Aquaporin-7(AQP7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aquaporin-7(AQP7) ELISA kit

E01A1617-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Aquaporin-7(AQP7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human AQP5/ Aquaporin-5 ELISA Kit

E0194Hu 1 Kit
EUR 571

Human AQP9/ Aquaporin-9 ELISA Kit

E0195Hu 1 Kit
EUR 571

ELISA kit for Human Aquaporin-9

EK4399 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Aquaporin-9 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human AQP1(Aquaporin-1) ELISA Kit

EH0964 96T
EUR 524.1
  • Detection range: 125-8000 pg/ml
  • Uniprot ID: P29972
  • Alias: AQP-1(Aquaporin 1)/AQP1/AQP-CHIP/CHIP28/CO/Aquaporin-CHIP
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 75pg/ml

Human AQP5(Aquaporin-5) ELISA Kit

EH0968 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P55064
  • Alias: AQP5/AQP-5/Aquaporin 5
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human AQP12A(Aquaporin-12A) ELISA Kit

EH1797 96T
EUR 567.6
  • Detection range: 78-5000 pg/ml
  • Uniprot ID: Q8IXF9
  • Alias: AQP12A/AQP12/AQPX2/Aquaporin-12A/AQP-12
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9pg/ml

Human AQP9(Aquaporin-9) ELISA Kit

EH2162 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: O43315
  • Alias: AQP9(Aquaporin-9)/Aquaglyceroporin-9/Small solute channel 1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Aquaporin- 6, AQP6 ELISA KIT

ELI-11210h 96 Tests
EUR 824

Human Aquaporin- 12B, AQP12B ELISA KIT

ELI-23831h 96 Tests
EUR 824

Human Aquaporin- 1, AQP1 ELISA KIT

ELI-02072h 96 Tests
EUR 824

Human Aquaporin- 2, AQP2 ELISA KIT

ELI-02074h 96 Tests
EUR 824

Human Aquaporin- 3, AQP3 ELISA KIT

ELI-02082h 96 Tests
EUR 824

Human Aquaporin- 4, AQP4 ELISA KIT

ELI-02087h 96 Tests
EUR 824

Human Aquaporin- 5, AQP5 ELISA KIT

ELI-02088h 96 Tests
EUR 824

Human Aquaporin- 9, AQP9 ELISA KIT

ELI-07090h 96 Tests
EUR 824

Human Aquaporin- 7, AQP7 ELISA KIT

ELI-34340h 96 Tests
EUR 824

Human Aquaporin- 12A, AQP12A ELISA KIT

ELI-34417h 96 Tests
EUR 824

Human Aquaporin- 10, AQP10 ELISA KIT

ELI-34418h 96 Tests
EUR 824

Human Aquaporin- 11, AQP11 ELISA KIT

ELI-49024h 96 Tests
EUR 824

Human Aquaporin 1 (AQP1) ELISA Kit

20-abx150727
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Aquaporin 4 (AQP4) ELISA Kit

20-abx150730
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Aquaporin 5 (AQP5) ELISA Kit

20-abx150731
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Aquaporin 9 (AQP9) ELISA Kit

20-abx150733
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Aquaporin 1 (AQP1) ELISA Kit

abx051765-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Aquaporin 2 (AQP2) ELISA Kit

abx051768-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Aquaporin 3 (AQP3) ELISA Kit

abx051771-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Aquaporin 4 (AQP4) ELISA Kit

abx051774-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Aquaporin 5 (AQP5) ELISA Kit

20-abx051778
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-10 working days.

Human Aquaporin 5 (AQP5) ELISA Kit

20-abx258788
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Aquaporin 12A (AQP12A) ELISA Kit

abx251105-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Aquaporin 1 (AQP1) ELISA Kit

abx253919-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Aquaporin 2 (AQP2) ELISA Kit

abx253920-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Aquaporin 3 (AQP3) ELISA Kit

abx253921-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Aquaporin 4 (AQP4) ELISA Kit

abx253922-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Aquaporin 4 (AQP4) ELISA Kit

DLR-AQP4-Hu-48T 48T
EUR 479
  • Should the Human Aquaporin 4 (AQP4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Aquaporin 4 (AQP4) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Aquaporin 4 (AQP4) ELISA Kit

DLR-AQP4-Hu-96T 96T
EUR 621
  • Should the Human Aquaporin 4 (AQP4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Aquaporin 4 (AQP4) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Aquaporin 5 (AQP5) ELISA Kit

DLR-AQP5-Hu-48T 48T
EUR 479
  • Should the Human Aquaporin 5 (AQP5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Aquaporin 5 (AQP5) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Aquaporin 5 (AQP5) ELISA Kit

DLR-AQP5-Hu-96T 96T
EUR 621
  • Should the Human Aquaporin 5 (AQP5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Aquaporin 5 (AQP5) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Aquaporin 9 (AQP9) ELISA Kit

DLR-AQP9-Hu-48T 48T
EUR 479
  • Should the Human Aquaporin 9 (AQP9) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Aquaporin 9 (AQP9) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Aquaporin 9 (AQP9) ELISA Kit

DLR-AQP9-Hu-96T 96T
EUR 621
  • Should the Human Aquaporin 9 (AQP9) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Aquaporin 9 (AQP9) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human AQP1/ Aquaporin-1 ELISA Kit

E0189Hu 1 Kit
EUR 571

Human AQP12A/ Aquaporin-12A ELISA Kit

E0190Hu 1 Kit
EUR 571

Human AQP2/ Aquaporin-2 ELISA Kit

E0191Hu 1 Kit
EUR 571

Human AQP3/ Aquaporin-3 ELISA Kit

E0192Hu 1 Kit
EUR 571

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/micca.org/public_html/wp-content/plugins/gentaur-linking/vendor_prefixed/pwpf/src/View/View.php on line 66

Human AQP8(Aquaporin 8) ELISA Kit