Human ASGR2(Asialoglycoprotein Receptor 2) ELISA Kit
Human Asialoglycoprotein Receptor 2 (ASGR2) ELISA Kit |
RD-ASGR2-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Asialoglycoprotein Receptor 2 (ASGR2) ELISA Kit |
RDR-ASGR2-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Asialoglycoprotein Receptor 2 (ASGR2) ELISA Kit |
RDR-ASGR2-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human ASGR2/ Asialoglycoprotein receptor 2 ELISA Kit |
E2881Hu |
Sunlong |
1 Kit |
EUR 605 |
Human ASGR2(Asialoglycoprotein Receptor 2) ELISA Kit |
EH2669 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: P07307
- Alias: ASGR2
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
Human Asialoglycoprotein receptor 2, ASGR2 ELISA KIT |
ELI-34137h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Asialoglycoprotein Receptor 2 (ASGR2) ELISA Kit |
20-abx150752 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Asialoglycoprotein Receptor 2 (ASGR2) ELISA Kit |
abx252045-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Asialoglycoprotein Receptor 2 (ASGR2) ELISA Kit |
SEC067Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Asialoglycoprotein Receptor 2 (ASGR2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Asialoglycoprotein Receptor 2 (ASGR2) in serum, plasma, tissue homogenates and other biological fluids. |
Human Asialoglycoprotein Receptor 2 (ASGR2) ELISA Kit |
SEC067Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Asialoglycoprotein Receptor 2 (ASGR2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Asialoglycoprotein Receptor 2 (ASGR2) in serum, plasma, tissue homogenates and other biological fluids. |
Human Asialoglycoprotein Receptor 2 (ASGR2) ELISA Kit |
SEC067Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Asialoglycoprotein Receptor 2 (ASGR2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Asialoglycoprotein Receptor 2 (ASGR2) in serum, plasma, tissue homogenates and other biological fluids. |
Human Asialoglycoprotein Receptor 2 (ASGR2) ELISA Kit |
SEC067Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Asialoglycoprotein Receptor 2 (ASGR2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Asialoglycoprotein Receptor 2 (ASGR2) in serum, plasma, tissue homogenates and other biological fluids. |
Human Asialoglycoprotein Receptor 2 (ASGR2) ELISA Kit |
4-SEC067Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Asialoglycoprotein Receptor 2 elisa. Alternative names of the recognized antigen: CLEC4H2
- Asialoglyco Protein Receptor 2
- C-type lectin domain family 4 member H2
- Hepatic lectin H2
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Asialoglycoprotein Receptor 2 (ASGR2) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Asialoglycoprotein Receptor 2 (ASGR2) Antibody |
20-abx126832 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Asialoglycoprotein Receptor 2 (ASGR2) Antibody |
20-abx128306 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Asialoglycoprotein Receptor 2 (ASGR2) Antibody |
20-abx111087 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Asialoglycoprotein Receptor 2 (ASGR2) Antibody |
abx036517-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Asialoglycoprotein Receptor 2 (ASGR2) Antibody |
20-abx006333 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Asialoglycoprotein Receptor 2 (ASGR2) Antibody |
20-abx301915 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Asialoglycoprotein Receptor 2 (ASGR2) Antibody |
abx230636-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Asialoglycoprotein Receptor 2 (ASGR2) Antibody |
20-abx171333 |
Abbexa |
|
|
|
Mouse Asialoglycoprotein receptor 2 (Asgr2) |
1-CSB-EP002208MO1 |
Cusabio |
-
EUR 505.00
-
EUR 265.00
-
EUR 1827.00
-
EUR 766.00
-
EUR 1218.00
-
EUR 335.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 29.9 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Mouse Asialoglycoprotein receptor 2 (Asgr2),partial expressed in E.coli |
Mouse Asialoglycoprotein receptor 2 (Asgr2) |
1-CSB-EP002208MO1b3 |
Cusabio |
-
EUR 505.00
-
EUR 265.00
-
EUR 1827.00
-
EUR 766.00
-
EUR 1218.00
-
EUR 335.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 45.9 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Mouse Asialoglycoprotein receptor 2 (Asgr2),Partial expressed in E.coli |
Recombinant Asialoglycoprotein Receptor 2 (ASGR2) |
4-RPC067Hu01 |
Cloud-Clone |
-
EUR 494.24
-
EUR 235.00
-
EUR 1578.40
-
EUR 592.80
-
EUR 1085.60
-
EUR 394.00
-
EUR 3796.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P07307
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 38.9kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Asialoglycoprotein Receptor 2 expressed in: E.coli |
Pig Asialoglycoprotein Receptor 2 (ASGR2) ELISA Kit |
abx360851-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Rabbit Asialoglycoprotein Receptor 2 (ASGR2) ELISA Kit |
abx363598-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Sheep Asialoglycoprotein Receptor 2 (ASGR2) ELISA Kit |
abx364247-96tests |
Abbexa |
96 tests |
EUR 926 |
- Shipped within 5-12 working days.
|
Mouse Asialoglycoprotein receptor 2, Asgr2 ELISA KIT |
ELI-24080m |
Lifescience Market |
96 Tests |
EUR 865 |
Monkey Asialoglycoprotein Receptor 2 (ASGR2) ELISA Kit |
abx358743-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Chicken Asialoglycoprotein Receptor 2 (ASGR2) ELISA Kit |
abx355518-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Mouse Asialoglycoprotein Receptor 2 (ASGR2) ELISA Kit |
abx388617-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Rat Asialoglycoprotein Receptor 2 (ASGR2) ELISA Kit |
abx390995-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Asialoglycoprotein Receptor 2 (ASGR2) Protein |
20-abx167030 |
Abbexa |
-
EUR 690.00
-
EUR 286.00
-
EUR 2124.00
-
EUR 815.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Human Asialoglycoprotein Receptor 2 (ASGR2) CLIA Kit |
abx196462-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Human Asialoglycoprotein Receptor 2 (ASGR2) CLIA Kit |
20-abx493442 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
ELISA kit for Human ASGR2 (Asialoglycoprotein Receptor 2) |
ELK3154 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Asialoglycoprotein Receptor 2 (ASGR2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific
- Show more
|
Description: A sandwich ELISA kit for detection of Asialoglycoprotein Receptor 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Human ASGR2 (Asialoglycoprotein Receptor 2) |
E-EL-H0509 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's ASGR2 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human ASGR2. Standards or samples are added to the micro ELISA plate wells and combined with
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Human ASGR2 (Asialoglycoprotein Receptor 2) in samples from Serum, Plasma, Cell supernatant |
Asialoglycoprotein Receptor 2 (ASGR2) Antibody (HRP) |
20-abx303139 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Asialoglycoprotein Receptor 2 (ASGR2) Antibody (FITC) |
20-abx303140 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Asialoglycoprotein Receptor 2 (ASGR2) Antibody (Biotin) |
20-abx303141 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Asgr2 ELISA Kit| Rat Asialoglycoprotein receptor 2 ELISA Kit |
EF018348 |
Lifescience Market |
96 Tests |
EUR 689 |
Asgr2 ELISA Kit| Mouse Asialoglycoprotein receptor 2 ELISA Kit |
EF014242 |
Lifescience Market |
96 Tests |
EUR 689 |
CLIA kit for Human ASGR2 (Asialoglycoprotein Receptor 2) |
E-CL-H0413 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 584 |
- Gentaur's ASGR2 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human ASGR2 . Standards or samples are added to the micro CLIA plate wells and combined with th
- Show more
|
Description: A sandwich CLIA kit for quantitative measurement of Human ASGR2 (Asialoglycoprotein Receptor 2) in samples from Serum, Plasma, Cell supernatant |
ASGR2 Asialoglycoprotein Receptor 2 Human Recombinant Protein |
PROTP07307 |
BosterBio |
Regular: 20ug |
EUR 317 |
Description: ASGR2 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 255 amino acids (80-311 a.a) and having a molecular mass of 28.9kDa.;ASGR2 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques. |
Asialoglycoprotein Receptor 2 (ASGR2) Polyclonal Antibody (Human, Bovine) |
4-PAC067Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ASGR2 (Met1~Ala311)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Bovine Asialoglycoprotein Receptor 2 (ASGR2) |
Asialoglycoprotein Receptor 2 (ASGR2) Polyclonal Antibody (Human, Bovine), APC |
4-PAC067Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ASGR2 (Met1~Ala311)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Bovine Asialoglycoprotein Receptor 2 (ASGR2). This antibody is labeled with APC. |
Asialoglycoprotein Receptor 2 (ASGR2) Polyclonal Antibody (Human, Bovine), Biotinylated |
4-PAC067Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ASGR2 (Met1~Ala311)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Bovine Asialoglycoprotein Receptor 2 (ASGR2). This antibody is labeled with Biotin. |
Asialoglycoprotein Receptor 2 (ASGR2) Polyclonal Antibody (Human, Bovine), Cy3 |
4-PAC067Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ASGR2 (Met1~Ala311)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Bovine Asialoglycoprotein Receptor 2 (ASGR2). This antibody is labeled with Cy3. |
Asialoglycoprotein Receptor 2 (ASGR2) Polyclonal Antibody (Human, Bovine), FITC |
4-PAC067Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ASGR2 (Met1~Ala311)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Bovine Asialoglycoprotein Receptor 2 (ASGR2). This antibody is labeled with FITC. |
Asialoglycoprotein Receptor 2 (ASGR2) Polyclonal Antibody (Human, Bovine), HRP |
4-PAC067Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ASGR2 (Met1~Ala311)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Bovine Asialoglycoprotein Receptor 2 (ASGR2). This antibody is labeled with HRP. |
Asialoglycoprotein Receptor 2 (ASGR2) Polyclonal Antibody (Human, Bovine), PE |
4-PAC067Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ASGR2 (Met1~Ala311)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Bovine Asialoglycoprotein Receptor 2 (ASGR2). This antibody is labeled with PE. |
Asialoglycoprotein Receptor 2 (ASGR2) Polyclonal Antibody (Human, Bovine), APC-Cy7 |
4-PAC067Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ASGR2 (Met1~Ala311)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Bovine Asialoglycoprotein Receptor 2 (ASGR2). This antibody is labeled with APC-Cy7. |
anti-Asialoglycoprotein Receptor 2 |
YF-PA10362 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to Asialoglycoprotein Receptor 2 |
anti-Asialoglycoprotein Receptor 2 |
YF-PA10363 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to Asialoglycoprotein Receptor 2 |
Human Asialoglycoprotein Receptor 1 ELISA kit |
E01A0607-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Asialoglycoprotein Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Asialoglycoprotein Receptor 1 ELISA kit |
E01A0607-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Asialoglycoprotein Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Asialoglycoprotein Receptor 1 ELISA kit |
E01A0607-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Asialoglycoprotein Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Anti-Asialoglycoprotein Receptor 2 (1D7) |
YF-MA10067 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to Asialoglycoprotein Receptor 2 |
Human ASGR1/ Asialoglycoprotein receptor 1 ELISA Kit |
E0211Hu |
Sunlong |
1 Kit |
EUR 571 |
ELISA kit for Human Asialoglycoprotein receptor 1 |
EK2928 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Asialoglycoprotein receptor 1 in samples from serum, plasma, tissue homogenates and other biological fluids. |
Human ASGR1(Asialoglycoprotein receptor 1) ELISA Kit |
EH1365 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: P07306
- Alias: ASGR1/ASGPR1/HL-1/CLEC4H1/MHL1/RHL1/ASGPR/ASGP-R 1/asialoglycoprotein receptor 1/C-type lectin domain family 4 member H1/Hepatic lectin H1
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
Human Asialoglycoprotein receptor 1, ASGR1 ELISA KIT |
ELI-03948h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Asialoglycoprotein Receptor 1 (ASGR1) ELISA Kit |
20-abx150751 |
Abbexa |
-
EUR 7112.00
-
EUR 3792.00
-
EUR 879.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Asialoglycoprotein Receptor 1 (ASGR1) ELISA Kit |
abx250636-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Asialoglycoprotein Receptor 1 (ASGR1) ELISA Kit |
DLR-ASGR1-Hu-48T |
DL Develop |
48T |
EUR 498 |
- Should the Human Asialoglycoprotein Receptor 1 (ASGR1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Asialoglycoprotein Receptor 1 (ASGR1) in samples from tissue homogenates or other biological fluids. |
Human Asialoglycoprotein Receptor 1 (ASGR1) ELISA Kit |
DLR-ASGR1-Hu-96T |
DL Develop |
96T |
EUR 647 |
- Should the Human Asialoglycoprotein Receptor 1 (ASGR1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Asialoglycoprotein Receptor 1 (ASGR1) in samples from tissue homogenates or other biological fluids. |
Human Asialoglycoprotein Receptor 1 (ASGR1) ELISA Kit |
SEB189Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4502.43 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Asialoglycoprotein Receptor 1 (ASGR1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Asialoglycoprotein Receptor 1 (ASGR1) in tissue homogenates and other biological fluids. |
Human Asialoglycoprotein Receptor 1 (ASGR1) ELISA Kit |
SEB189Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 458.44 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Asialoglycoprotein Receptor 1 (ASGR1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Asialoglycoprotein Receptor 1 (ASGR1) in tissue homogenates and other biological fluids. |
Human Asialoglycoprotein Receptor 1 (ASGR1) ELISA Kit |
SEB189Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 612.05 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Asialoglycoprotein Receptor 1 (ASGR1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Asialoglycoprotein Receptor 1 (ASGR1) in tissue homogenates and other biological fluids. |
Human Asialoglycoprotein Receptor 1 (ASGR1) ELISA Kit |
SEB189Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2454.23 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Asialoglycoprotein Receptor 1 (ASGR1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Asialoglycoprotein Receptor 1 (ASGR1) in tissue homogenates and other biological fluids. |
Human Asialoglycoprotein Receptor 1 (ASGR1) ELISA Kit |
4-SEB189Hu |
Cloud-Clone |
-
EUR 4553.00
-
EUR 2405.00
-
EUR 613.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Asialoglycoprotein Receptor 1 elisa. Alternative names of the recognized antigen: CLEC4H1
- HL-1
- ASGPR 1
- Asialoglyco protein Receptor
- C-type lectin domain family 4 member H1
- Hepatic lectin H1
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Asialoglycoprotein Receptor 1 (ASGR1) in samples from tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Human Asialoglycoprotein Receptor 1 ELISA Kit (ASGR1) |
RK00949 |
Abclonal |
96 Tests |
EUR 521 |
Human Asialoglycoprotein Receptor 1 (ASGR1) ELISA Kit |
RD-ASGR1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500 |
Human Asialoglycoprotein Receptor 1 (ASGR1) ELISA Kit |
RD-ASGR1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
Human Asialoglycoprotein Receptor 1 (ASGR1) ELISA Kit |
RDR-ASGR1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 522 |
Human Asialoglycoprotein Receptor 1 (ASGR1) ELISA Kit |
RDR-ASGR1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 724 |
Rabbit Asialoglycoprotein Receptor 1 ELISA kit |
E04A0607-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Asialoglycoprotein Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Asialoglycoprotein Receptor 1 ELISA kit |
E04A0607-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Asialoglycoprotein Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Asialoglycoprotein Receptor 1 ELISA kit |
E04A0607-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Asialoglycoprotein Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Asialoglycoprotein Receptor 1 ELISA kit |
E06A0607-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Asialoglycoprotein Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Asialoglycoprotein Receptor 1 ELISA kit |
E06A0607-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Asialoglycoprotein Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Asialoglycoprotein Receptor 1 ELISA kit |
E06A0607-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Asialoglycoprotein Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Asialoglycoprotein Receptor 1 ELISA kit |
E02A0607-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Asialoglycoprotein Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Asialoglycoprotein Receptor 1 ELISA kit |
E02A0607-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Asialoglycoprotein Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Asialoglycoprotein Receptor 1 ELISA kit |
E02A0607-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Asialoglycoprotein Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Asialoglycoprotein Receptor 1 ELISA kit |
E03A0607-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Asialoglycoprotein Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Asialoglycoprotein Receptor 1 ELISA kit |
E03A0607-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Asialoglycoprotein Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Asialoglycoprotein Receptor 1 ELISA kit |
E03A0607-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Asialoglycoprotein Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Asialoglycoprotein Receptor 1 ELISA kit |
E08A0607-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Canine Asialoglycoprotein Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Asialoglycoprotein Receptor 1 ELISA kit |
E08A0607-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Canine Asialoglycoprotein Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Asialoglycoprotein Receptor 1 ELISA kit |
E08A0607-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Canine Asialoglycoprotein Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Asialoglycoprotein Receptor 1 ELISA kit |
E07A0607-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Porcine Asialoglycoprotein Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Asialoglycoprotein Receptor 1 ELISA kit |
E07A0607-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Porcine Asialoglycoprotein Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Asialoglycoprotein Receptor 1 ELISA kit |
E07A0607-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Porcine Asialoglycoprotein Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Asialoglycoprotein Receptor 1 ELISA kit |
E09A0607-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Monkey Asialoglycoprotein Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Asialoglycoprotein Receptor 1 ELISA kit |
E09A0607-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Monkey Asialoglycoprotein Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Asialoglycoprotein Receptor 1 ELISA kit |
E09A0607-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Monkey Asialoglycoprotein Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
ELISA kit for Human ASGR1 (Asialoglycoprotein Receptor 1) |
ELK1676 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Asialoglycoprotein Receptor 1 (ASGR1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific
- Show more
|
Description: A sandwich ELISA kit for detection of Asialoglycoprotein Receptor 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Human ASGR1 (Asialoglycoprotein Receptor 1) |
E-EL-H0510 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's ASGR1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human ASGR1. Standards or samples are added to the micro ELISA plate wells and combined with
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Human ASGR1 (Asialoglycoprotein Receptor 1) in samples from Serum, Plasma, Cell supernatant |
Pig Asialoglycoprotein Receptor 1 (ASGR1) ELISA Kit |
abx360769-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Rabbit Asialoglycoprotein Receptor 1 (ASGR1) ELISA Kit |
abx363789-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Mouse Asialoglycoprotein Receptor 1 (ASGR1) ELISA Kit |
abx515715-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Rat Asialoglycoprotein Receptor 1 (ASGR1) ELISA Kit |
abx515716-96tests |
Abbexa |
96 tests |
EUR 786 |
- Shipped within 5-12 working days.
|
Guinea pig Asialoglycoprotein Receptor 1 ELISA kit |
E05A0607-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Guinea pig Asialoglycoprotein Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Asialoglycoprotein Receptor 1 ELISA kit |
E05A0607-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Guinea pig Asialoglycoprotein Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Asialoglycoprotein Receptor 1 ELISA kit |
E05A0607-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Guinea pig Asialoglycoprotein Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Asialoglycoprotein receptor 1, Asgr1 ELISA KIT |
ELI-03946m |
Lifescience Market |
96 Tests |
EUR 865 |
Rat Asialoglycoprotein receptor 1, Asgr1 ELISA KIT |
ELI-03947r |
Lifescience Market |
96 Tests |
EUR 886 |
Mouse ASGR1(Asialoglycoprotein Receptor 1) ELISA Kit |
EM0855 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 31.25-2000 pg/ml
- Uniprot ID: P34927
- Alias: ASGR1/ASGPR1/CLEC4H1/MHL1/RHL1/ASGPR/ASGPR 1/ASGP-R 1/asialoglycoprotein receptor 1/CLEC4H1ASGPR1/C-type lectin domain family 4 member H1/Hepatic lectin H1/HL-1
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 18.75pg/ml |
Rat Asialoglycoprotein Receptor 1 (ASGR1) ELISA Kit |
abx353506-96tests |
Abbexa |
96 tests |
EUR 786 |
- Shipped within 5-12 working days.
|
Chicken Asialoglycoprotein Receptor 1 (ASGR1) ELISA Kit |
abx357136-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Monkey Asialoglycoprotein Receptor 1 (ASGR1) ELISA Kit |
abx359056-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Mouse Asialoglycoprotein Receptor 1 (ASGR1) ELISA Kit |
abx255197-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Human Asialoglycoprotein receptor 1 (ASGR1) |
1-CSB-RP174694h |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 29.7 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Asialoglycoprotein receptor 1(ASGR1),partial expressed in E.coli |
Human Asialoglycoprotein Receptor 1 (ASGR1) CLIA Kit |
abx196461-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Human Asialoglycoprotein Receptor 1 (ASGR1) CLIA Kit |
20-abx492476 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
ASGR1 ELISA Kit| Mouse Asialoglycoprotein Receptor 1 ELISA Kit |
EF013453 |
Lifescience Market |
96 Tests |
EUR 689 |
ELISA kit for Mouse ASGR1 (Asialoglycoprotein Receptor 1) |
E-EL-M0159 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's ASGR1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse ASGR1. Standards or samples are added to the micro ELISA plate wells and combined with
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Mouse ASGR1 (Asialoglycoprotein Receptor 1) in samples from Serum, Plasma, Cell supernatant |
Guinea pig Asialoglycoprotein Receptor 1 (ASGR1) ELISA Kit |
abx357736-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
ELISA kit for Rat ASGR1 (Asialoglycoprotein Receptor 1) |
E-EL-R0075 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's ASGR1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat ASGR1. Standards or samples are added to the micro ELISA plate wells and combined with th
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Rat ASGR1 (Asialoglycoprotein Receptor 1) in samples from Serum, Plasma, Cell supernatant |
Human Asialoglycoprotein Receptor 1 (ASGR1) Protein |
20-abx166846 |
Abbexa |
-
EUR 676.00
-
EUR 286.00
-
EUR 2082.00
-
EUR 801.00
-
EUR 481.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
CLIA kit for Human ASGR1 (Asialoglycoprotein Receptor 1) |
E-CL-H0414 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 584 |
- Gentaur's ASGR1 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human ASGR1 . Standards or samples are added to the micro CLIA plate wells and combined with th
- Show more
|
Description: A sandwich CLIA kit for quantitative measurement of Human ASGR1 (Asialoglycoprotein Receptor 1) in samples from Serum, Plasma, Cell supernatant |
Asialoglycoprotein Receptor 1 (ASGR1) Antibody |
20-abx128768 |
Abbexa |
-
EUR 411.00
-
EUR 133.00
-
EUR 1149.00
-
EUR 565.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Asialoglycoprotein Receptor 1 (ASGR1) Antibody |
20-abx129663 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1177.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Asialoglycoprotein Receptor 1 (ASGR1) Antibody |
20-abx109556 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Asialoglycoprotein Receptor 1 (ASGR1) Antibody |
20-abx111086 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Asialoglycoprotein Receptor 1 (ASGR1) Antibody |
abx036739-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Asialoglycoprotein Receptor 1 (ASGR1) Antibody |
20-abx006394 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Asialoglycoprotein Receptor 1 (ASGR1) Antibody |
abx028618-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Asialoglycoprotein Receptor 1 (ASGR1) Antibody |
abx028618-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Asialoglycoprotein Receptor 1 (ASGR1) Antibody |
20-abx339945 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Asialoglycoprotein Receptor 1 (ASGR1) Antibody |
abx230635-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Asialoglycoprotein Receptor 1 (ASGR1) Antibody |
20-abx171332 |
Abbexa |
|
|
|
Mouse Asialoglycoprotein receptor 1 (Asgr1) |
1-CSB-YP002207MO |
Cusabio |
-
EUR 504.00
-
EUR 265.00
-
EUR 1832.00
-
EUR 763.00
-
EUR 1216.00
-
EUR 334.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 27.8 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Mouse Asialoglycoprotein receptor 1(Asgr1),partial expressed in Yeast |
Mouse Asialoglycoprotein receptor 1 (Asgr1) |
1-CSB-EP002207MO |
Cusabio |
-
EUR 505.00
-
EUR 265.00
-
EUR 1827.00
-
EUR 766.00
-
EUR 1218.00
-
EUR 335.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 52.8 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Mouse Asialoglycoprotein receptor 1(Asgr1),partial expressed in E.coli |
Recombinant Asialoglycoprotein Receptor 1 (ASGR1) |
4-RPB189Hu01 |
Cloud-Clone |
-
EUR 485.28
-
EUR 233.00
-
EUR 1544.80
-
EUR 581.60
-
EUR 1063.20
-
EUR 388.00
-
EUR 3712.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P07306
- Buffer composition: 100mMNaHCO3, 500mMNaCl, pH8.3, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 28.2kDa
- Isoelectric Point: 5.8
|
Description: Recombinant Human Asialoglycoprotein Receptor 1 expressed in: E.coli |
Recombinant Asialoglycoprotein Receptor 1 (ASGR1) |
4-RPB189Mu01 |
Cloud-Clone |
-
EUR 503.20
-
EUR 238.00
-
EUR 1612.00
-
EUR 604.00
-
EUR 1108.00
-
EUR 400.00
-
EUR 3880.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P34927
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 27.1kDa
- Isoelectric Point: 6.1
|
Description: Recombinant Mouse Asialoglycoprotein Receptor 1 expressed in: E.coli |
Mouse Asialoglycoprotein Receptor 1 (ASGR1) CLIA Kit |
abx196732-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Human ASGR2 Antibody |
33449-05111 |
AssayPro |
150 ug |
EUR 261 |
Asialoglycoprotein Receptor 1 (ASGR1) Antibody Pair |
abx117588-1pair5x96wellplates |
Abbexa |
1 pair (5x96 well plates) |
EUR 1010 |
- Shipped within 5-10 working days.
|
Mouse Asialoglycoprotein Receptor 1 (ASGR1) Protein |
20-abx168418 |
Abbexa |
-
EUR 704.00
-
EUR 286.00
-
EUR 2165.00
-
EUR 829.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Asialoglycoprotein Receptor 1 (ASGR1) Antibody (Biotin) |
20-abx105163 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Asialoglycoprotein Receptor 1 (ASGR1) Antibody (FITC) |
20-abx106580 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Asialoglycoprotein Receptor 1 (ASGR1) Antibody (HRP) |
20-abx107997 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
CLIA kit for Mouse ASGR1 (Asialoglycoprotein Receptor 1) |
E-CL-M0119 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 584 |
- Gentaur's ASGR1 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Mouse ASGR1 . Standards or samples are added to the micro CLIA plate wells and combined with th
- Show more
|
Description: A sandwich CLIA kit for quantitative measurement of Mouse ASGR1 (Asialoglycoprotein Receptor 1) in samples from Serum, Plasma, Cell supernatant |
Recombinant Human Asialoglycoprotein Receptor 1/ASGPR1 (C-6His) |
C428-10ug |
Novoprotein |
10ug |
EUR 131 |
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.2. |
Recombinant Human Asialoglycoprotein Receptor 1/ASGPR1 (C-6His) |
C428-1mg |
Novoprotein |
1mg |
EUR 2283 |
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.2. |
Recombinant Human Asialoglycoprotein Receptor 1/ASGPR1 (C-6His) |
C428-500ug |
Novoprotein |
500ug |
EUR 1613 |
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.2. |
Recombinant Human Asialoglycoprotein Receptor 1/ASGPR1 (C-6His) |
C428-50ug |
Novoprotein |
50ug |
EUR 273 |
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.2. |
Asialoglycoprotein Receptor 1 (ASGR1) Polyclonal Antibody (Human, Pig) |
4-PAB189Hu01 |
Cloud-Clone |
-
EUR 239.00
-
EUR 2391.00
-
EUR 598.00
-
EUR 299.00
-
EUR 211.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ASGR1 (Phe77~Pro289)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Pig Asialoglycoprotein Receptor 1 (ASGR1) |
ASGR2 siRNA |
20-abx900475 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ASGR2 siRNA |
20-abx908332 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ASGR2 siRNA |
20-abx908333 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ASGR2 Protein |
20-abx260966 |
Abbexa |
-
EUR 3418.00
-
EUR 328.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
ASGR2 antibody |
70R-2075 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal ASGR2 antibody raised against the N terminal of ASGR2 |
ASGR2 Antibody |
39942-100ul |
SAB |
100ul |
EUR 390 |
ASGR2 antibody |
70R-1145 |
Fitzgerald |
100 ug |
EUR 377 |
Description: Rabbit polyclonal ASGR2 antibody raised against the N terminal of ASGR2 |
ASGR2 antibody |
70R-15866 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal ASGR2 antibody |
ASGR2 Antibody |
1-CSB-PA002208GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against ASGR2. Recognizes ASGR2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
ASGR2 Antibody |
1-CSB-PA002208LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ASGR2. Recognizes ASGR2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200 |
AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS |
AP-STR-KIT-2 |
CORNING |
1/pk |
EUR 367 |
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller |
ASGR2 sgRNA CRISPR Lentivector (Human) (Target 2) |
K0134103 |
ABM |
1.0 ug DNA |
EUR 154 |
Human ASGR2 shRNA Plasmid |
20-abx950312 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
ASGR2 Recombinant Protein (Human) |
RP002062 |
ABM |
100 ug |
Ask for price |
Asialoglycoprotein Receptor 1 (ASGR1) Polyclonal Antibody (Mouse) |
4-PAB189Mu01 |
Cloud-Clone |
-
EUR 243.00
-
EUR 2457.00
-
EUR 613.00
-
EUR 305.00
-
EUR 212.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ASGR1 (Thr80~Asp281)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Asialoglycoprotein Receptor 1 (ASGR1) |
Asialoglycoprotein Receptor 1 (ASGR1) Polyclonal Antibody (Human, Pig), APC |
4-PAB189Hu01-APC |
Cloud-Clone |
-
EUR 333.00
-
EUR 3113.00
-
EUR 872.00
-
EUR 423.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ASGR1 (Phe77~Pro289)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Pig Asialoglycoprotein Receptor 1 (ASGR1). This antibody is labeled with APC. |
Asialoglycoprotein Receptor 1 (ASGR1) Polyclonal Antibody (Human, Pig), Biotinylated |
4-PAB189Hu01-Biotin |
Cloud-Clone |
-
EUR 303.00
-
EUR 2341.00
-
EUR 697.00
-
EUR 369.00
-
EUR 216.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ASGR1 (Phe77~Pro289)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Pig Asialoglycoprotein Receptor 1 (ASGR1). This antibody is labeled with Biotin. |
Asialoglycoprotein Receptor 1 (ASGR1) Polyclonal Antibody (Human, Pig), Cy3 |
4-PAB189Hu01-Cy3 |
Cloud-Clone |
-
EUR 403.00
-
EUR 4109.00
-
EUR 1121.00
-
EUR 523.00
-
EUR 245.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ASGR1 (Phe77~Pro289)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Pig Asialoglycoprotein Receptor 1 (ASGR1). This antibody is labeled with Cy3. |
Asialoglycoprotein Receptor 1 (ASGR1) Polyclonal Antibody (Human, Pig), FITC |
4-PAB189Hu01-FITC |
Cloud-Clone |
-
EUR 287.00
-
EUR 2510.00
-
EUR 717.00
-
EUR 359.00
-
EUR 192.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ASGR1 (Phe77~Pro289)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Pig Asialoglycoprotein Receptor 1 (ASGR1). This antibody is labeled with FITC. |
Asialoglycoprotein Receptor 1 (ASGR1) Polyclonal Antibody (Human, Pig), HRP |
4-PAB189Hu01-HRP |
Cloud-Clone |
-
EUR 305.00
-
EUR 2714.00
-
EUR 772.00
-
EUR 383.00
-
EUR 203.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ASGR1 (Phe77~Pro289)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Pig Asialoglycoprotein Receptor 1 (ASGR1). This antibody is labeled with HRP. |
Asialoglycoprotein Receptor 1 (ASGR1) Polyclonal Antibody (Human, Pig), PE |
4-PAB189Hu01-PE |
Cloud-Clone |
-
EUR 287.00
-
EUR 2510.00
-
EUR 717.00
-
EUR 359.00
-
EUR 192.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ASGR1 (Phe77~Pro289)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Pig Asialoglycoprotein Receptor 1 (ASGR1). This antibody is labeled with PE. |
Anti-VEGF Receptor 2/KDR Antibody |
A00901-2 |
BosterBio |
100ug/vial |
EUR 334 |
Anti-Adiponectin Receptor 2 (mouse) Antibody |
A02218-2 |
BosterBio |
200ug |
EUR 498 |
Description: Goat Polyclonal Adiponectin Receptor 2 (mouse) Antibody. Validated in IF, IHC and tested in Mouse. |
RARRES2 Human, Retinoic Acid Receptor Responder 2 Human Recombinant Protein,Sf9 |
PROTQ99969-2 |
BosterBio |
Regular: 5ug |
EUR 317 |
Description: RARRES2 produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 146 amino acids (21-157a.a.) and having a molecular mass of 16.9kDa. (Molecular size on SDS-PAGE will appear at approximately 18-28kDa). RARRES2 is expressed with a 6 amino acid His tag at C-Terminus and purified by proprietary chromatographic techniques. |
TNFR2 Tumor Necrosis Factor Receptor Type 2 Human Recombinant Protein |
PROTP20333-2 |
BosterBio |
Regular: 20ug |
EUR 317 |
Description: TNFR2 Human produced in E.Coli is a single, non-glycosylated polypeptide chain containing 184 amino acids and having a molecular mass of 20kDa. The TNFR2 is purified by proprietary chromatographic techniques. |
anti- ASGR2 antibody |
FNab00636 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:200-1:1000
- IP: 1:200-1:1000
- IHC: 1:50-1:500
- Immunogen: asialoglycoprotein receptor 2
- Uniprot ID: P07307
- Gene ID: 433
- Research Area: Immunology, Signal Transduction
|
Description: Antibody raised against ASGR2 |
ASGR2 Rabbit pAb |
A11830-100ul |
Abclonal |
100 ul |
EUR 308 |
ASGR2 Rabbit pAb |
A11830-200ul |
Abclonal |
200 ul |
EUR 459 |
ASGR2 Rabbit pAb |
A11830-20ul |
Abclonal |
20 ul |
Ask for price |
ASGR2 Rabbit pAb |
A11830-50ul |
Abclonal |
50 ul |
Ask for price |
ASGR2 Polyclonal Antibody |
A62110 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
ASGR2 Rabbit pAb |
A6281-100ul |
Abclonal |
100 ul |
EUR 308 |
ASGR2 Rabbit pAb |
A6281-200ul |
Abclonal |
200 ul |
EUR 459 |
ASGR2 Rabbit pAb |
A6281-20ul |
Abclonal |
20 ul |
EUR 183 |
ASGR2 Rabbit pAb |
A6281-50ul |
Abclonal |
50 ul |
EUR 223 |
ASGR2 Rabbit pAb |
A13949-100ul |
Abclonal |
100 ul |
EUR 308 |
ASGR2 Rabbit pAb |
A13949-200ul |
Abclonal |
200 ul |
EUR 459 |
ASGR2 Rabbit pAb |
A13949-20ul |
Abclonal |
20 ul |
EUR 183 |
ASGR2 Rabbit pAb |
A13949-50ul |
Abclonal |
50 ul |
EUR 223 |
ASGR2 Blocking Peptide |
33R-5548 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ASGR2 antibody, catalog no. 70R-2075 |
ASGR2 Blocking Peptide |
33R-8876 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ASGR2 antibody, catalog no. 70R-1145 |
ASGR2 Polyclonal Antibody |
30711-100ul |
SAB |
100ul |
EUR 252 |
ASGR2 Polyclonal Antibody |
30711-50ul |
SAB |
50ul |
EUR 187 |
ASGR2 Polyclonal Antibody |
28410-100ul |
SAB |
100ul |
EUR 252 |
ASGR2 Polyclonal Antibody |
28410-50ul |
SAB |
50ul |
EUR 187 |
ASGR2 cloning plasmid |
CSB-CL002208HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 864
- Sequence: atggccaaggactttcaagatatccagcagctgagctcggaggaaaatgaccatcctttccatcaagggccacctcctgcccagcccctggcacagcgtctctgctccatggtctgcttcagtctgcttgccctgagcttcaacatcctgctgctggtggtcatctgtgtgactgg
- Show more
|
Description: A cloning plasmid for the ASGR2 gene. |
Anti-ASGR2 antibody |
STJ28203 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a subunit of the asialoglycoprotein receptor. This receptor is a transmembrane protein that plays a critical role in serum glycoprotein homeostasis by mediating the endocytosis and lysosomal degradation of glycoproteins with exposed terminal galactose or N-acetylgalactosamine residues. The asialoglycoprotein receptor may facilitate hepatic infection by multiple viruses including hepatitis B, and is also a target for liver-specific drug delivery. The asialoglycoprotein receptor is a hetero-oligomeric protein composed of major and minor subunits, which are encoded by different genes. The protein encoded by this gene is the less abundant minor subunit. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. |
Anti-ASGR2 antibody |
STJ113409 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a subunit of the asialoglycoprotein receptor. This receptor is a transmembrane protein that plays a critical role in serum glycoprotein homeostasis by mediating the endocytosis and lysosomal degradation of glycoproteins with exposed terminal galactose or N-acetylgalactosamine residues. The asialoglycoprotein receptor may facilitate hepatic infection by multiple viruses including hepatitis B, and is also a target for liver-specific drug delivery. The asialoglycoprotein receptor is a hetero-oligomeric protein composed of major and minor subunits, which are encoded by different genes. The protein encoded by this gene is the less abundant minor subunit. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. |
Anti-ASGR2 antibody |
STJ115884 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a subunit of the asialoglycoprotein receptor. This receptor is a transmembrane protein that plays a critical role in serum glycoprotein homeostasis by mediating the endocytosis and lysosomal degradation of glycoproteins with exposed terminal galactose or N-acetylgalactosamine residues. The asialoglycoprotein receptor may facilitate hepatic infection by multiple viruses including hepatitis B, and is also a target for liver-specific drug delivery. The asialoglycoprotein receptor is a hetero-oligomeric protein composed of major and minor subunits, which are encoded by different genes. The protein encoded by this gene is the less abundant minor subunit. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. |
Asialoglycoprotein Receptor 1 (ASGR1) Polyclonal Antibody (Mouse), APC |
4-PAB189Mu01-APC |
Cloud-Clone |
-
EUR 340.00
-
EUR 3203.00
-
EUR 894.00
-
EUR 432.00
-
EUR 217.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ASGR1 (Thr80~Asp281)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Asialoglycoprotein Receptor 1 (ASGR1). This antibody is labeled with APC. |
Asialoglycoprotein Receptor 1 (ASGR1) Polyclonal Antibody (Mouse), Biotinylated |
4-PAB189Mu01-Biotin |
Cloud-Clone |
-
EUR 307.00
-
EUR 2407.00
-
EUR 714.00
-
EUR 375.00
-
EUR 217.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ASGR1 (Thr80~Asp281)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Asialoglycoprotein Receptor 1 (ASGR1). This antibody is labeled with Biotin. |
Asialoglycoprotein Receptor 1 (ASGR1) Polyclonal Antibody (Mouse), Cy3 |
4-PAB189Mu01-Cy3 |
Cloud-Clone |
-
EUR 411.00
-
EUR 4229.00
-
EUR 1151.00
-
EUR 535.00
-
EUR 248.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ASGR1 (Thr80~Asp281)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Asialoglycoprotein Receptor 1 (ASGR1). This antibody is labeled with Cy3. |
Asialoglycoprotein Receptor 1 (ASGR1) Polyclonal Antibody (Mouse), FITC |
4-PAB189Mu01-FITC |
Cloud-Clone |
-
EUR 292.00
-
EUR 2582.00
-
EUR 735.00
-
EUR 366.00
-
EUR 194.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ASGR1 (Thr80~Asp281)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Asialoglycoprotein Receptor 1 (ASGR1). This antibody is labeled with FITC. |
Asialoglycoprotein Receptor 1 (ASGR1) Polyclonal Antibody (Mouse), HRP |
4-PAB189Mu01-HRP |
Cloud-Clone |
-
EUR 311.00
-
EUR 2792.00
-
EUR 791.00
-
EUR 391.00
-
EUR 205.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ASGR1 (Thr80~Asp281)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Asialoglycoprotein Receptor 1 (ASGR1). This antibody is labeled with HRP. |
Asialoglycoprotein Receptor 1 (ASGR1) Polyclonal Antibody (Mouse), PE |
4-PAB189Mu01-PE |
Cloud-Clone |
-
EUR 292.00
-
EUR 2582.00
-
EUR 735.00
-
EUR 366.00
-
EUR 194.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ASGR1 (Thr80~Asp281)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Asialoglycoprotein Receptor 1 (ASGR1). This antibody is labeled with PE. |
Human ASGR2 Antibody (Biotin Conjugate) |
33449-05121 |
AssayPro |
150 ug |
EUR 369 |
ASGR2 ORF Vector (Human) (pORF) |
ORF000688 |
ABM |
1.0 ug DNA |
EUR 95 |
Asialoglycoprotein Receptor 1 (ASGR1) Polyclonal Antibody (Human, Pig), APC-Cy7 |
4-PAB189Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 547.00
-
EUR 6106.00
-
EUR 1624.00
-
EUR 727.00
-
EUR 310.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ASGR1 (Phe77~Pro289)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Pig Asialoglycoprotein Receptor 1 (ASGR1). This antibody is labeled with APC-Cy7. |
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
Asgr2 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3389203 |
ABM |
1.0 ug DNA |
EUR 154 |
Asgr2 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6907503 |
ABM |
1.0 ug DNA |
EUR 154 |
Column Packing Kit |
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
Human ASGR2(Asialoglycoprotein Receptor 2) ELISA Kit