Human BLMH(Bleomycin Hydrolase) ELISA Kit

Human BLMH(Bleomycin Hydrolase) ELISA Kit

Human Bleomycin Hydrolase (BLMH) ELISA Kit

RD-BLMH-Hu-48Tests 48 Tests
EUR 521

Human Bleomycin Hydrolase (BLMH) ELISA Kit

RD-BLMH-Hu-96Tests 96 Tests
EUR 723

Human Bleomycin Hydrolase (BLMH) ELISA Kit

RDR-BLMH-Hu-48Tests 48 Tests
EUR 544

Human Bleomycin Hydrolase (BLMH) ELISA Kit

RDR-BLMH-Hu-96Tests 96 Tests
EUR 756

Human Bleomycin hydrolase(BLMH) ELISA kit

E01B0805-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Bleomycin hydrolase(BLMH) ELISA kit

E01B0805-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Bleomycin hydrolase(BLMH) ELISA kit

E01B0805-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Bleomycin hydrolase, BLMH ELISA KIT

ELI-50039h 96 Tests
EUR 824

Human Bleomycin Hydrolase (BLMH) ELISA Kit

20-abx150813
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Bleomycin hydrolase(BLMH) ELISA kit

CSB-EL002716HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Bleomycin hydrolase (BLMH) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Bleomycin hydrolase(BLMH) ELISA kit

1-CSB-EL002716HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Bleomycin hydrolase(BLMH) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Bleomycin Hydrolase (BLMH) ELISA Kit

SEC220Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Bleomycin Hydrolase (BLMH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Bleomycin Hydrolase (BLMH) in tissue homogenates, cell lysates and other biological fluids.

Human Bleomycin Hydrolase (BLMH) ELISA Kit

SEC220Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Bleomycin Hydrolase (BLMH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Bleomycin Hydrolase (BLMH) in tissue homogenates, cell lysates and other biological fluids.

Human Bleomycin Hydrolase (BLMH) ELISA Kit

SEC220Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Bleomycin Hydrolase (BLMH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Bleomycin Hydrolase (BLMH) in tissue homogenates, cell lysates and other biological fluids.

Human Bleomycin Hydrolase (BLMH) ELISA Kit

SEC220Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Bleomycin Hydrolase (BLMH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Bleomycin Hydrolase (BLMH) in tissue homogenates, cell lysates and other biological fluids.

Human Bleomycin Hydrolase (BLMH) ELISA Kit

4-SEC220Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Bleomycin Hydrolase elisa. Alternative names of the recognized antigen: BH
  • BMH
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Bleomycin Hydrolase (BLMH) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Bleomycin Hydrolase ELISA Kit (BLMH)

RK00979 96 Tests
EUR 521

Bleomycin Hydrolase (BLMH) Antibody

20-abx111231
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Bleomycin Hydrolase (BLMH) Antibody

20-abx101837
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Bleomycin Hydrolase (BLMH) Antibody

20-abx101838
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Bleomycin Hydrolase (BLMH) Antibody

20-abx101839
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Bleomycin Hydrolase (BLMH) Antibody

20-abx101840
  • EUR 342.00
  • EUR 871.00
  • EUR 453.00
  • EUR 154.00
  • EUR 272.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.

Bleomycin Hydrolase (BLMH) Antibody

abx034944-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Bleomycin Hydrolase (BLMH) Antibody

abx034944-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Bleomycin Hydrolase (BLMH) Antibody

20-abx005014
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Bleomycin Hydrolase (BLMH) Antibody

20-abx320093
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Bleomycin Hydrolase (BLMH) Antibody

20-abx321698
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Bleomycin Hydrolase (BLMH) Antibody

abx230907-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Bleomycin Hydrolase (BLMH) Antibody

20-abx171422
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Recombinant Bleomycin Hydrolase (BLMH)

4-RPC220Hu01
  • EUR 440.48
  • EUR 221.00
  • EUR 1376.80
  • EUR 525.60
  • EUR 951.20
  • EUR 358.00
  • EUR 3292.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q13867
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 32.9kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Bleomycin Hydrolase expressed in: E.coli

Recombinant Bleomycin Hydrolase (BLMH)

4-RPC220Mu01
  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q8R016
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 21.8kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Bleomycin Hydrolase expressed in: E.coli

Recombinant Bleomycin Hydrolase (BLMH)

4-RPC220Ra01
  • EUR 332.96
  • EUR 192.00
  • EUR 973.60
  • EUR 391.20
  • EUR 682.40
  • EUR 286.00
  • EUR 2284.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P70645
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 21.6kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Bleomycin Hydrolase expressed in: E.coli

Goat Bleomycin hydrolase(BLMH) ELISA kit

E06B0805-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Bleomycin hydrolase(BLMH) ELISA kit

E06B0805-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Bleomycin hydrolase(BLMH) ELISA kit

E06B0805-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Bleomycin hydrolase(BLMH) ELISA kit

E02B0805-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Bleomycin hydrolase(BLMH) ELISA kit

E02B0805-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Bleomycin hydrolase(BLMH) ELISA kit

E02B0805-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Bleomycin hydrolase(BLMH) ELISA kit

E03B0805-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Bleomycin hydrolase(BLMH) ELISA kit

E03B0805-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Bleomycin hydrolase(BLMH) ELISA kit

E03B0805-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Bleomycin hydrolase(BLMH) ELISA kit

E04B0805-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Bleomycin hydrolase(BLMH) ELISA kit

E04B0805-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Bleomycin hydrolase(BLMH) ELISA kit

E04B0805-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Bleomycin hydrolase(BLMH) ELISA kit

E07B0805-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Bleomycin hydrolase(BLMH) ELISA kit

E07B0805-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Bleomycin hydrolase(BLMH) ELISA kit

E07B0805-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Bleomycin hydrolase(BLMH) ELISA kit

E09B0805-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Bleomycin hydrolase(BLMH) ELISA kit

E09B0805-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Bleomycin hydrolase(BLMH) ELISA kit

E09B0805-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Bleomycin hydrolase(BLMH) ELISA kit

E08B0805-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Bleomycin hydrolase(BLMH) ELISA kit

E08B0805-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Bleomycin hydrolase(BLMH) ELISA kit

E08B0805-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Chicken Bleomycin hydrolase, BLMH ELISA KIT

ELI-11925c 96 Tests
EUR 928

Mouse Bleomycin hydrolase, Blmh ELISA KIT

ELI-11926m 96 Tests
EUR 865

Rabbit Bleomycin hydrolase, BLMH ELISA KIT

ELI-33313Ra 96 Tests
EUR 928

Mouse Bleomycin Hydrolase (BLMH) ELISA Kit

abx388691-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat Bleomycin Hydrolase (BLMH) ELISA Kit

abx391026-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Bleomycin Hydrolase (BLMH) Protein

20-abx065545
  • EUR 620.00
  • EUR 272.00
  • EUR 1859.00
  • EUR 732.00
  • EUR 453.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Human Bleomycin Hydrolase (BLMH) CLIA Kit

20-abx190301
  • EUR 7911.00
  • EUR 4215.00
  • EUR 973.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Bleomycin Hydrolase (BLMH)CLIA Kit

SCC220Hu-10x96wellstestplate 10x96-wells test plate
EUR 5647.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Bleomycin Hydrolase (BLMH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Bleomycin Hydrolase (BLMH) in Tissue homogenates and other biological fluids.

Human Bleomycin Hydrolase (BLMH)CLIA Kit

SCC220Hu-1x48wellstestplate 1x48-wells test plate
EUR 552.76
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Bleomycin Hydrolase (BLMH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Bleomycin Hydrolase (BLMH) in Tissue homogenates and other biological fluids.

Human Bleomycin Hydrolase (BLMH)CLIA Kit

SCC220Hu-1x96wellstestplate 1x96-wells test plate
EUR 746.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Bleomycin Hydrolase (BLMH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Bleomycin Hydrolase (BLMH) in Tissue homogenates and other biological fluids.

Human Bleomycin Hydrolase (BLMH)CLIA Kit

SCC220Hu-5x96wellstestplate 5x96-wells test plate
EUR 3060.6
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Bleomycin Hydrolase (BLMH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Bleomycin Hydrolase (BLMH) in Tissue homogenates and other biological fluids.

Human Bleomycin Hydrolase (BLMH) CLIA Kit

4-SCC220Hu
  • EUR 5698.00
  • EUR 3061.00
  • EUR 747.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Bleomycin Hydrolase Clia kit. Alternative names of the recognized antigen: BH
  • BMH
Description: Double-antibody Sandwich chemiluminescent immunoassay for detection of Human Bleomycin Hydrolase (BLMH)Tissue homogenates and other biological fluids

ELISA kit for Human BLMH (Bleomycin Hydrolase)

ELK3153 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Bleomycin Hydrolase (BLMH). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Bleomyc
  • Show more
Description: A sandwich ELISA kit for detection of Bleomycin Hydrolase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Rat Bleomycin Hydrolase (BLMH) Protein

20-abx065546
  • EUR 481.00
  • EUR 230.00
  • EUR 1330.00
  • EUR 551.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Mouse Bleomycin Hydrolase (BLMH) Protein

20-abx065547
  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Bleomycin Hydrolase (BLMH) Antibody (FITC)

20-abx273637
  • EUR 481.00
  • EUR 244.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Bleomycin Hydrolase (BLMH) Antibody (Biotin)

20-abx272261
  • EUR 453.00
  • EUR 244.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Bleomycin Hydrolase (BLMH) Antibody (Biotin)

20-abx273337
  • EUR 481.00
  • EUR 244.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Guinea pig Bleomycin hydrolase(BLMH) ELISA kit

E05B0805-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Bleomycin hydrolase(BLMH) ELISA kit

E05B0805-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Bleomycin hydrolase(BLMH) ELISA kit

E05B0805-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Bleomycin Hydrolase (BLMH) Polyclonal Antibody (Human)

4-PAC220Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: BLMH (Met213~Trp447)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Bleomycin Hydrolase (BLMH)

BLMH Bleomycin Hydrolase Human Recombinant Protein

PROTQ13867 Regular: 20ug
EUR 317
Description: BLMH produced in E.Coli is a single, non-glycosylated polypeptide chain containing 475 amino acids (1-455a.a.) and having a molecular mass of 54.7kDa.;BLMH is fused to a 20 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Blmh ELISA Kit| Rat Bleomycin hydrolase ELISA Kit

EF018379 96 Tests
EUR 689

BLMH ELISA Kit| chicken Bleomycin hydrolase ELISA Kit

EF012220 96 Tests
EUR 689

Blmh ELISA Kit| Mouse Bleomycin hydrolase ELISA Kit

EF014316 96 Tests
EUR 689

Bleomycin Hydrolase (BLMH) Polyclonal Antibody (Mouse)

4-PAC220Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: BLMH (Ala27~Cys164)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Bleomycin Hydrolase (BLMH)

Bleomycin Hydrolase (BLMH) Polyclonal Antibody (Rat)

4-PAC220Ra01
  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: BLMH (Val30~Phe165)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Bleomycin Hydrolase (BLMH)

Bleomycin Hydrolase (BLMH) Monoclonal Antibody (Rat)

4-MAC220Ra21
  • EUR 260.00
  • EUR 2721.00
  • EUR 673.00
  • EUR 329.00
  • EUR 220.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Val30~Phe165
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Rat Bleomycin Hydrolase (BLMH)

Bleomycin Hydrolase (BLMH) Polyclonal Antibody (Human), APC

4-PAC220Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: BLMH (Met213~Trp447)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Bleomycin Hydrolase (BLMH). This antibody is labeled with APC.

Bleomycin Hydrolase (BLMH) Polyclonal Antibody (Human), Biotinylated

4-PAC220Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: BLMH (Met213~Trp447)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Bleomycin Hydrolase (BLMH). This antibody is labeled with Biotin.

Bleomycin Hydrolase (BLMH) Polyclonal Antibody (Human), Cy3

4-PAC220Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: BLMH (Met213~Trp447)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Bleomycin Hydrolase (BLMH). This antibody is labeled with Cy3.

Bleomycin Hydrolase (BLMH) Polyclonal Antibody (Human), FITC

4-PAC220Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: BLMH (Met213~Trp447)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Bleomycin Hydrolase (BLMH). This antibody is labeled with FITC.

Bleomycin Hydrolase (BLMH) Polyclonal Antibody (Human), HRP

4-PAC220Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: BLMH (Met213~Trp447)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Bleomycin Hydrolase (BLMH). This antibody is labeled with HRP.

Bleomycin Hydrolase (BLMH) Polyclonal Antibody (Human), PE

4-PAC220Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: BLMH (Met213~Trp447)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Bleomycin Hydrolase (BLMH). This antibody is labeled with PE.

Bleomycin Hydrolase (BLMH) Polyclonal Antibody (Mouse), APC

4-PAC220Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: BLMH (Ala27~Cys164)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Bleomycin Hydrolase (BLMH). This antibody is labeled with APC.

Bleomycin Hydrolase (BLMH) Polyclonal Antibody (Mouse), Biotinylated

4-PAC220Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: BLMH (Ala27~Cys164)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Bleomycin Hydrolase (BLMH). This antibody is labeled with Biotin.

Bleomycin Hydrolase (BLMH) Polyclonal Antibody (Mouse), Cy3

4-PAC220Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: BLMH (Ala27~Cys164)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Bleomycin Hydrolase (BLMH). This antibody is labeled with Cy3.

Bleomycin Hydrolase (BLMH) Polyclonal Antibody (Mouse), FITC

4-PAC220Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: BLMH (Ala27~Cys164)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Bleomycin Hydrolase (BLMH). This antibody is labeled with FITC.

Bleomycin Hydrolase (BLMH) Polyclonal Antibody (Mouse), HRP

4-PAC220Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: BLMH (Ala27~Cys164)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Bleomycin Hydrolase (BLMH). This antibody is labeled with HRP.

Bleomycin Hydrolase (BLMH) Polyclonal Antibody (Mouse), PE

4-PAC220Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: BLMH (Ala27~Cys164)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Bleomycin Hydrolase (BLMH). This antibody is labeled with PE.

Bleomycin Hydrolase (BLMH) Polyclonal Antibody (Rat), APC

4-PAC220Ra01-APC
  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: BLMH (Val30~Phe165)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Bleomycin Hydrolase (BLMH). This antibody is labeled with APC.

Bleomycin Hydrolase (BLMH) Polyclonal Antibody (Rat), Biotinylated

4-PAC220Ra01-Biotin
  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: BLMH (Val30~Phe165)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Bleomycin Hydrolase (BLMH). This antibody is labeled with Biotin.

Bleomycin Hydrolase (BLMH) Polyclonal Antibody (Rat), Cy3

4-PAC220Ra01-Cy3
  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: BLMH (Val30~Phe165)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Bleomycin Hydrolase (BLMH). This antibody is labeled with Cy3.

Bleomycin Hydrolase (BLMH) Polyclonal Antibody (Rat), FITC

4-PAC220Ra01-FITC
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: BLMH (Val30~Phe165)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Bleomycin Hydrolase (BLMH). This antibody is labeled with FITC.

Bleomycin Hydrolase (BLMH) Polyclonal Antibody (Rat), HRP

4-PAC220Ra01-HRP
  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: BLMH (Val30~Phe165)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Bleomycin Hydrolase (BLMH). This antibody is labeled with HRP.

Bleomycin Hydrolase (BLMH) Polyclonal Antibody (Rat), PE

4-PAC220Ra01-PE
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: BLMH (Val30~Phe165)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Bleomycin Hydrolase (BLMH). This antibody is labeled with PE.

Bleomycin Hydrolase (BLMH) Monoclonal Antibody (Rat), APC

4-MAC220Ra21-APC
  • EUR 365.00
  • EUR 3563.00
  • EUR 984.00
  • EUR 468.00
  • EUR 228.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Val30~Phe165
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Rat Bleomycin Hydrolase (BLMH). This antibody is labeled with APC.

Bleomycin Hydrolase (BLMH) Monoclonal Antibody (Rat), Biotinylated

4-MAC220Ra21-Biotin
  • EUR 326.00
  • EUR 2671.00
  • EUR 780.00
  • EUR 402.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Val30~Phe165
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Rat Bleomycin Hydrolase (BLMH). This antibody is labeled with Biotin.

Bleomycin Hydrolase (BLMH) Monoclonal Antibody (Rat), Cy3

4-MAC220Ra21-Cy3
  • EUR 445.00
  • EUR 4709.00
  • EUR 1271.00
  • EUR 583.00
  • EUR 263.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Val30~Phe165
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Rat Bleomycin Hydrolase (BLMH). This antibody is labeled with Cy3.

Bleomycin Hydrolase (BLMH) Monoclonal Antibody (Rat), FITC

4-MAC220Ra21-FITC
  • EUR 312.00
  • EUR 2870.00
  • EUR 807.00
  • EUR 395.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Val30~Phe165
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Rat Bleomycin Hydrolase (BLMH). This antibody is labeled with FITC.

Bleomycin Hydrolase (BLMH) Monoclonal Antibody (Rat), HRP

4-MAC220Ra21-HRP
  • EUR 333.00
  • EUR 3104.00
  • EUR 869.00
  • EUR 422.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Val30~Phe165
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Rat Bleomycin Hydrolase (BLMH). This antibody is labeled with HRP.

Bleomycin Hydrolase (BLMH) Monoclonal Antibody (Rat), PE

4-MAC220Ra21-PE
  • EUR 312.00
  • EUR 2870.00
  • EUR 807.00
  • EUR 395.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Val30~Phe165
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Rat Bleomycin Hydrolase (BLMH). This antibody is labeled with PE.

Bleomycin Hydrolase (BLMH) Polyclonal Antibody (Human), APC-Cy7

4-PAC220Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: BLMH (Met213~Trp447)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Bleomycin Hydrolase (BLMH). This antibody is labeled with APC-Cy7.

Bleomycin Hydrolase (BLMH) Polyclonal Antibody (Mouse), APC-Cy7

4-PAC220Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: BLMH (Ala27~Cys164)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Bleomycin Hydrolase (BLMH). This antibody is labeled with APC-Cy7.

Bleomycin Hydrolase (BLMH) Polyclonal Antibody (Rat), APC-Cy7

4-PAC220Ra01-APC-Cy7
  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: BLMH (Val30~Phe165)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Bleomycin Hydrolase (BLMH). This antibody is labeled with APC-Cy7.

Bleomycin Hydrolase (BLMH) Monoclonal Antibody (Rat), APC-Cy7

4-MAC220Ra21-APC-Cy7
  • EUR 610.00
  • EUR 7006.00
  • EUR 1849.00
  • EUR 817.00
  • EUR 337.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Val30~Phe165
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Rat Bleomycin Hydrolase (BLMH). This antibody is labeled with APC-Cy7.

Bleomycin Hydrolase (Recombinant)

20-abx073168
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Recombinant Human Bleomycin Hydrolase

7-02527 5µg Ask for price

Recombinant Human Bleomycin Hydrolase

7-02528 20µg Ask for price

Recombinant Human Bleomycin Hydrolase

7-02529 1mg Ask for price

Blmh/ Rat Blmh ELISA Kit

ELI-33363r 96 Tests
EUR 886

BLMH ELISA KIT|Human

EF008123 96 Tests
EUR 689

Bleomycin

B053-10MG 10 mg
EUR 224

Bleomycin

B053-50MG 50 mg
EUR 708

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

Human Recombinant BLMH

6392-100
EUR 457

Bleomycin (sulfate)

HY-17565 50mg
EUR 821

Bleomycin sulfate

GA7621-10MG 10 mg
EUR 102

Bleomycin sulfate

GA7621-25MG 25 mg
EUR 174

Bleomycin sulfate

GA7621-5MG 5 mg
EUR 74

Bleomycin Sulfate

A8331-10 10 mg
EUR 187
Description: Bleomycin sulfate (BLENOXANE®) is a mixture of cytotoxic glycopeptide antibiotics produced by a strain of streptomyces verticillus.

Bleomycin Sulfate

A8331-5.1 10 mM (in 1mL DMSO)
EUR 340
Description: Bleomycin sulfate (BLENOXANE®) is a mixture of cytotoxic glycopeptide antibiotics produced by a strain of streptomyces verticillus.

Bleomycin Sulfate

A8331-50 50 mg
EUR 593
Description: Bleomycin sulfate (BLENOXANE®) is a mixture of cytotoxic glycopeptide antibiotics produced by a strain of streptomyces verticillus.

Bleomycin Sulfate

A8331-S Evaluation Sample
EUR 81
Description: Bleomycin sulfate (BLENOXANE®) is a mixture of cytotoxic glycopeptide antibiotics produced by a strain of streptomyces verticillus.

Bleomycin sulfate

2246-10
EUR 305

Bleomycin sulfate

2246-50
EUR 1023

BLMH siRNA

20-abx909134
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

BLMH siRNA

20-abx909135
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

BLMH antibody

70R-2880 50 ug
EUR 467
Description: Rabbit polyclonal BLMH antibody raised against the middle region of BLMH

BLMH Antibody

35402-100ul 100ul
EUR 390

BLMH antibody

38988-100ul 100ul
EUR 252

BLMH antibody

10R-1335 100 ug
EUR 512
Description: Mouse monoclonal BLMH antibody

BLMH antibody

70R-16004 50 ul
EUR 435
Description: Rabbit polyclonal BLMH antibody

BLMH Antibody

DF12855 200ul
EUR 304
Description: BLMH Antibody detects endogenous levels of BLMH.

BLMH Antibody

1-CSB-PA002716ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against BLMH. Recognizes BLMH from Human. This antibody is Unconjugated. Tested in the following application: ELISA

BLMH Antibody

1-CSB-PA002716ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against BLMH. Recognizes BLMH from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

BLMH Antibody

1-CSB-PA002716GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against BLMH. Recognizes BLMH from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

pOTB7-BLMH

PVT18564 2 ug
EUR 231

anti-BLMH

YF-PA10486 50 ug
EUR 363
Description: Mouse polyclonal to BLMH

anti-BLMH

YF-PA23303 50 ul
EUR 334
Description: Mouse polyclonal to BLMH

Human BLMH shRNA Plasmid

20-abx950438
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

BLMH Recombinant Protein (Human)

RP003082 100 ug Ask for price

Bleomycin A5 hydrochloride

B004-10MG 10 mg
EUR 188

Bleomycin A5 hydrochloride

B004-50MG 50 mg
EUR 397

Bleomycin sulfate USP

B005-10MG 10 mg
EUR 210

Bleomycin sulfate USP

B005-50MG 50 mg
EUR 575

Bleomycin A5 (hydrochloride)

C3370-10 10 mg
EUR 328
Description: Bleomycin A5 is an anticancer chemotherapeutic that binds DNA and induces DNA cleavage and strand breaks, it is highly toxic. Additionally, this compound induces apoptosis, alters cell cycle regulation, inhibits proliferation, and decreases tumor size in cellular and animal models of hemangioma.

Bleomycin A5 (hydrochloride)

C3370-25 25 mg
EUR 659
Description: Bleomycin A5 is an anticancer chemotherapeutic that binds DNA and induces DNA cleavage and strand breaks, it is highly toxic. Additionally, this compound induces apoptosis, alters cell cycle regulation, inhibits proliferation, and decreases tumor size in cellular and animal models of hemangioma.

Bleomycin A5 (hydrochloride)

C3370-5 5 mg
EUR 206
Description: Bleomycin A5 is an anticancer chemotherapeutic that binds DNA and induces DNA cleavage and strand breaks, it is highly toxic. Additionally, this compound induces apoptosis, alters cell cycle regulation, inhibits proliferation, and decreases tumor size in cellular and animal models of hemangioma.

Human Acyloxyacyl hydrolase(AOAH) ELISA kit

E01A1552-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Acyloxyacyl hydrolase(AOAH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Acyloxyacyl hydrolase(AOAH) ELISA kit

E01A1552-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Acyloxyacyl hydrolase(AOAH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Acyloxyacyl hydrolase(AOAH) ELISA kit

E01A1552-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Acyloxyacyl hydrolase(AOAH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human γ Glutamate Hydrolase ELISA kit

E01G0559-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human γ Glutamate Hydrolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human γ Glutamate Hydrolase ELISA kit

E01G0559-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human γ Glutamate Hydrolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human γ Glutamate Hydrolase ELISA kit

E01G0559-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human γ Glutamate Hydrolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Hydroxyacylglutathione hydrolase, Mitochondrial ELISA kit

E01H0015-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Hydroxyacylglutathione hydrolase, Mitochondrial in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Hydroxyacylglutathione hydrolase, Mitochondrial ELISA kit

E01H0015-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Hydroxyacylglutathione hydrolase, Mitochondrial in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Hydroxyacylglutathione hydrolase, Mitochondrial ELISA kit

E01H0015-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Hydroxyacylglutathione hydrolase, Mitochondrial in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human HAGH(Hydroxyacylglutathione Hydrolase) ELISA Kit

EH3210 96T
EUR 524.1
  • Detection range: 0.313-20 ng/ml
  • Uniprot ID: Q16775
  • Alias: HAGH/GLX2/HAGH/GLO2hydroxyacyl glutathione hydrolase/Glx II/GLXII/Glyoxalase II/HAGH1GLX2/hydroxyacylglutathione hydrolase/hydroxyacylglutathione hydrolase, mitochondrial/hydroxyacylglutathion
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human Valacyclovir hydrolase, BPHL ELISA KIT

ELI-11153h 96 Tests
EUR 824

Human Acyloxyacyl hydrolase, AOAH ELISA KIT

ELI-34429h 96 Tests
EUR 824

Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit

20-abx150541
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Fumarylacetoacetate Hydrolase (FAH) ELISA Kit

20-abx151482
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Valacyclovir Hydrolase (BPHL) ELISA Kit

20-abx386067
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

Human Hydroxyacylglutathione Hydrolase (HAGH) ELISA Kit

abx252611-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Acyloxyacyl Hydrolase (AOAH)ELISA Kit

201-12-2818 96 tests
EUR 440
  • This Acyloxyacyl Hydrolase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit

DLR-AOAH-Hu-48T 48T
EUR 517
  • Should the Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Acyloxyacyl Hydrolase (AOAH) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit

DLR-AOAH-Hu-96T 96T
EUR 673
  • Should the Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Acyloxyacyl Hydrolase (AOAH) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Human Acyloxyacyl hydrolase(AOAH) ELISA kit

CSB-EL001853HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Acyloxyacyl hydrolase (AOAH) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Acyloxyacyl hydrolase(AOAH) ELISA kit

1-CSB-EL001853HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Acyloxyacyl hydrolase(AOAH) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Fumarylacetoacetate Hydrolase ELISA Kit (FAH)

RK01355 96 Tests
EUR 521

Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit

RD-AOAH-Hu-48Tests 48 Tests
EUR 521

Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit

RD-AOAH-Hu-96Tests 96 Tests
EUR 723

Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit

RDR-AOAH-Hu-48Tests 48 Tests
EUR 544

Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit

RDR-AOAH-Hu-96Tests 96 Tests
EUR 756

Human Hydroxyacylglutathione Hydrolase(HAGH)ELISA Kit

QY-E01881 96T
EUR 361

Human Fumarylacetoacetate Hydrolase(FAH)ELISA Kit

QY-E00564 96T
EUR 361

Human Acyloxyacyl Hydrolase(AOAH)ELISA Kit

QY-E00892 96T
EUR 361

Human Fumarylacetoacetate Hydrolase (FAH) ELISA Kit

SEJ123Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fumarylacetoacetate Hydrolase (FAH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fumarylacetoacetate Hydrolase (FAH) in serum, plasma, tissue homogenates and other biological fluids.

Human Fumarylacetoacetate Hydrolase (FAH) ELISA Kit

SEJ123Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fumarylacetoacetate Hydrolase (FAH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fumarylacetoacetate Hydrolase (FAH) in serum, plasma, tissue homogenates and other biological fluids.

Human Fumarylacetoacetate Hydrolase (FAH) ELISA Kit

SEJ123Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fumarylacetoacetate Hydrolase (FAH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fumarylacetoacetate Hydrolase (FAH) in serum, plasma, tissue homogenates and other biological fluids.

Human Fumarylacetoacetate Hydrolase (FAH) ELISA Kit

SEJ123Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fumarylacetoacetate Hydrolase (FAH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fumarylacetoacetate Hydrolase (FAH) in serum, plasma, tissue homogenates and other biological fluids.

Human Fumarylacetoacetate Hydrolase (FAH) ELISA Kit

4-SEJ123Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Fumarylacetoacetate Hydrolase elisa. Alternative names of the recognized antigen: FAA
  • Fumarylacetoacetase
  • Tyrosinemia 1
  • Beta-diketonase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Fumarylacetoacetate Hydrolase (FAH) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit

SEJ634Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Acyloxyacyl Hydrolase (AOAH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Acyloxyacyl Hydrolase (AOAH) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit

SEJ634Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Acyloxyacyl Hydrolase (AOAH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Acyloxyacyl Hydrolase (AOAH) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit

SEJ634Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Acyloxyacyl Hydrolase (AOAH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Acyloxyacyl Hydrolase (AOAH) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit

SEJ634Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Acyloxyacyl Hydrolase (AOAH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Acyloxyacyl Hydrolase (AOAH) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit

4-SEJ634Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Acyloxyacyl Hydrolase elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Acyloxyacyl Hydrolase (AOAH) in samples from serum, plasma, tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

BLMH Conjugated Antibody

C38988 100ul
EUR 397

BLMH cloning plasmid

CSB-CL002716HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1368
  • Sequence: atgagcagctcgggactgaattcggagaaggtagctgctctgatacagaaactgaattccgacccccagttcgtacttgcccagaatgtcgggaccacccacgacctgctggacatctgtctgaagcgggccacggtgcagcgcgcgcagcatgtgttccagcacgccgtgcccc
  • Show more
Description: A cloning plasmid for the BLMH gene.

anti- BLMH antibody

FNab00907 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:20 - 1:50
  • Immunogen: bleomycin hydrolase
  • Uniprot ID: Q13867
  • Gene ID: 642
  • Research Area: Cardiovascular, Metabolism
Description: Antibody raised against BLMH

BLMH Rabbit pAb

A6535-100ul 100 ul
EUR 308

BLMH Rabbit pAb

A6535-200ul 200 ul
EUR 459

BLMH Rabbit pAb

A6535-20ul 20 ul
EUR 183

BLMH Rabbit pAb

A6535-50ul 50 ul
EUR 223

BLMH Blocking Peptide

33R-2825 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of BLMH antibody, catalog no. 70R-2880

BLMH Blocking Peptide

DF12855-BP 1mg
EUR 195

Anti-BLMH antibody

PAab00907 100 ug
EUR 355

Anti-BLMH antibody

STJ28618 100 µl
EUR 277
Description: Bleomycin hydrolase (BMH) is a cytoplasmic cysteine peptidase that is highly conserved through evolution; however, the only known activity of the enzyme is metabolic inactivation of the glycopeptide bleomycin (BLM), an essential component of combination chemotherapy regimens for cancer. The protein contains the signature active site residues of the cysteine protease papain superfamily.

Anti-BLMH (4A2)

YF-MA10095 100 ug
EUR 363
Description: Mouse monoclonal to BLMH

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

BLMH ORF Vector (Human) (pORF)

ORF001028 1.0 ug DNA
EUR 95

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

Human S-formylglutathione hydrolase (ESD) ELISA Kit

abx555912-96tests 96 tests
EUR 668
  • Shipped within 1-3 weeks.

Human Leukotriene A4 Hydrolase (LTA4H) ELISA Kit

abx572445-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Epoxide hydrolase 1(EPHX1) ELISA kit

E01E0380-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Epoxide hydrolase 1(EPHX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Epoxide hydrolase 1(EPHX1) ELISA kit

E01E0380-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Epoxide hydrolase 1(EPHX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Epoxide hydrolase 1(EPHX1) ELISA kit

E01E0380-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Epoxide hydrolase 1(EPHX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Epoxide hydrolase 2(EPHX2) ELISA kit

E01E0381-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Epoxide hydrolase 2(EPHX2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Epoxide hydrolase 2(EPHX2) ELISA kit

E01E0381-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Epoxide hydrolase 2(EPHX2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Epoxide hydrolase 2(EPHX2) ELISA kit

E01E0381-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Epoxide hydrolase 2(EPHX2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Leukotriene A4 Hydrolase (LTA4H) ELISA kit

E01L0040-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Leukotriene A4 Hydrolase (LTA4H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Leukotriene A4 Hydrolase (LTA4H) ELISA kit

E01L0040-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Leukotriene A4 Hydrolase (LTA4H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human BLMH(Bleomycin Hydrolase) ELISA Kit