Human BLMH(Bleomycin Hydrolase) ELISA Kit

Human BLMH(Bleomycin Hydrolase) ELISA Kit

Human Bleomycin Hydrolase (BLMH) ELISA Kit
RD-BLMH-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Bleomycin Hydrolase (BLMH) ELISA Kit
RD-BLMH-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Bleomycin Hydrolase (BLMH) ELISA Kit
RDR-BLMH-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Bleomycin Hydrolase (BLMH) ELISA Kit
RDR-BLMH-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Bleomycin hydrolase(BLMH) ELISA kit
E01B0805-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Bleomycin hydrolase(BLMH) ELISA kit
E01B0805-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Bleomycin hydrolase(BLMH) ELISA kit
E01B0805-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Bleomycin hydrolase, BLMH ELISA KIT
ELI-50039h	Lifescience Market	96 Tests	EUR 824

Human Bleomycin Hydrolase (BLMH) ELISA Kit
20-abx150813	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Bleomycin hydrolase(BLMH) ELISA kit
CSB-EL002716HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Bleomycin hydrolase (BLMH) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Bleomycin hydrolase(BLMH) ELISA kit
1-CSB-EL002716HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Bleomycin hydrolase(BLMH) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Bleomycin Hydrolase (BLMH) ELISA Kit
SEC220Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Bleomycin Hydrolase (BLMH) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Bleomycin Hydrolase (BLMH) in tissue homogenates, cell lysates and other biological fluids.

Human Bleomycin Hydrolase (BLMH) ELISA Kit
SEC220Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Bleomycin Hydrolase (BLMH) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Bleomycin Hydrolase (BLMH) in tissue homogenates, cell lysates and other biological fluids.

Human Bleomycin Hydrolase (BLMH) ELISA Kit
SEC220Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Bleomycin Hydrolase (BLMH) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Bleomycin Hydrolase (BLMH) in tissue homogenates, cell lysates and other biological fluids.

Human Bleomycin Hydrolase (BLMH) ELISA Kit
SEC220Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Bleomycin Hydrolase (BLMH) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Bleomycin Hydrolase (BLMH) in tissue homogenates, cell lysates and other biological fluids.

Human Bleomycin Hydrolase (BLMH) ELISA Kit
4-SEC220Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Bleomycin Hydrolase elisa. Alternative names of the recognized antigen: BH BMH
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Bleomycin Hydrolase (BLMH) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Bleomycin Hydrolase ELISA Kit (BLMH)
RK00979	Abclonal	96 Tests	EUR 521

Bleomycin Hydrolase (BLMH) Antibody
20-abx111231	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Bleomycin Hydrolase (BLMH) Antibody
20-abx101837	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Bleomycin Hydrolase (BLMH) Antibody
20-abx101838	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Bleomycin Hydrolase (BLMH) Antibody
20-abx101839	Abbexa	EUR 453.00 EUR 133.00 EUR 1302.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Bleomycin Hydrolase (BLMH) Antibody
20-abx101840	Abbexa	EUR 342.00 EUR 871.00 EUR 453.00 EUR 154.00 EUR 272.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-7 working days.

Bleomycin Hydrolase (BLMH) Antibody
abx034944-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Bleomycin Hydrolase (BLMH) Antibody
abx034944-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Bleomycin Hydrolase (BLMH) Antibody
20-abx005014	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Bleomycin Hydrolase (BLMH) Antibody
20-abx320093	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Bleomycin Hydrolase (BLMH) Antibody
20-abx321698	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Bleomycin Hydrolase (BLMH) Antibody
abx230907-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Bleomycin Hydrolase (BLMH) Antibody
20-abx171422	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Recombinant Bleomycin Hydrolase (BLMH)
4-RPC220Hu01	Cloud-Clone	EUR 440.48 EUR 221.00 EUR 1376.80 EUR 525.60 EUR 951.20 EUR 358.00 EUR 3292.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q13867 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 32.9kDa Isoelectric Point: Inquire
Description: Recombinant Human Bleomycin Hydrolase expressed in: E.coli

Recombinant Bleomycin Hydrolase (BLMH)
4-RPC220Mu01	Cloud-Clone	EUR 467.36 EUR 228.00 EUR 1477.60 EUR 559.20 EUR 1018.40 EUR 376.00 EUR 3544.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q8R016 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 21.8kDa Isoelectric Point: Inquire
Description: Recombinant Mouse Bleomycin Hydrolase expressed in: E.coli

Recombinant Bleomycin Hydrolase (BLMH)
4-RPC220Ra01	Cloud-Clone	EUR 332.96 EUR 192.00 EUR 973.60 EUR 391.20 EUR 682.40 EUR 286.00 EUR 2284.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P70645 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 21.6kDa Isoelectric Point: Inquire
Description: Recombinant Rat Bleomycin Hydrolase expressed in: E.coli

Goat Bleomycin hydrolase(BLMH) ELISA kit
E06B0805-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Bleomycin hydrolase(BLMH) ELISA kit
E06B0805-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Bleomycin hydrolase(BLMH) ELISA kit
E06B0805-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Bleomycin hydrolase(BLMH) ELISA kit
E02B0805-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Bleomycin hydrolase(BLMH) ELISA kit
E02B0805-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Bleomycin hydrolase(BLMH) ELISA kit
E02B0805-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Bleomycin hydrolase(BLMH) ELISA kit
E03B0805-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Bleomycin hydrolase(BLMH) ELISA kit
E03B0805-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Bleomycin hydrolase(BLMH) ELISA kit
E03B0805-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Bleomycin hydrolase(BLMH) ELISA kit
E04B0805-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Bleomycin hydrolase(BLMH) ELISA kit
E04B0805-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Bleomycin hydrolase(BLMH) ELISA kit
E04B0805-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Bleomycin hydrolase(BLMH) ELISA kit
E07B0805-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Bleomycin hydrolase(BLMH) ELISA kit
E07B0805-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Bleomycin hydrolase(BLMH) ELISA kit
E07B0805-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Bleomycin hydrolase(BLMH) ELISA kit
E09B0805-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Bleomycin hydrolase(BLMH) ELISA kit
E09B0805-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Bleomycin hydrolase(BLMH) ELISA kit
E09B0805-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Bleomycin hydrolase(BLMH) ELISA kit
E08B0805-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Bleomycin hydrolase(BLMH) ELISA kit
E08B0805-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Bleomycin hydrolase(BLMH) ELISA kit
E08B0805-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Chicken Bleomycin hydrolase, BLMH ELISA KIT
ELI-11925c	Lifescience Market	96 Tests	EUR 928

Mouse Bleomycin hydrolase, Blmh ELISA KIT
ELI-11926m	Lifescience Market	96 Tests	EUR 865

Rabbit Bleomycin hydrolase, BLMH ELISA KIT
ELI-33313Ra	Lifescience Market	96 Tests	EUR 928

Mouse Bleomycin Hydrolase (BLMH) ELISA Kit
abx388691-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Rat Bleomycin Hydrolase (BLMH) ELISA Kit
abx391026-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Bleomycin Hydrolase (BLMH) Protein
20-abx065545	Abbexa	EUR 620.00 EUR 272.00 EUR 1859.00 EUR 732.00 EUR 453.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Human Bleomycin Hydrolase (BLMH) CLIA Kit
20-abx190301	Abbexa	EUR 7911.00 EUR 4215.00 EUR 973.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Bleomycin Hydrolase (BLMH)CLIA Kit
SCC220Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5647.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Bleomycin Hydrolase (BLMH) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Bleomycin Hydrolase (BLMH) in Tissue homogenates and other biological fluids.

Human Bleomycin Hydrolase (BLMH)CLIA Kit
SCC220Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 552.76
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Bleomycin Hydrolase (BLMH) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Bleomycin Hydrolase (BLMH) in Tissue homogenates and other biological fluids.

Human Bleomycin Hydrolase (BLMH)CLIA Kit
SCC220Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 746.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Bleomycin Hydrolase (BLMH) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Bleomycin Hydrolase (BLMH) in Tissue homogenates and other biological fluids.

Human Bleomycin Hydrolase (BLMH)CLIA Kit
SCC220Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 3060.6
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Bleomycin Hydrolase (BLMH) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Bleomycin Hydrolase (BLMH) in Tissue homogenates and other biological fluids.

Human Bleomycin Hydrolase (BLMH) CLIA Kit
4-SCC220Hu	Cloud-Clone	EUR 5698.00 EUR 3061.00 EUR 747.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Bleomycin Hydrolase Clia kit. Alternative names of the recognized antigen: BH BMH
Description: Double-antibody Sandwich chemiluminescent immunoassay for detection of Human Bleomycin Hydrolase (BLMH)Tissue homogenates and other biological fluids

ELISA kit for Human BLMH (Bleomycin Hydrolase)
ELK3153	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Bleomycin Hydrolase (BLMH). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Bleomyc Show more
Description: A sandwich ELISA kit for detection of Bleomycin Hydrolase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Rat Bleomycin Hydrolase (BLMH) Protein
20-abx065546	Abbexa	EUR 481.00 EUR 230.00 EUR 1330.00 EUR 551.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Mouse Bleomycin Hydrolase (BLMH) Protein
20-abx065547	Abbexa	EUR 648.00 EUR 272.00 EUR 1998.00 EUR 773.00 EUR 467.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Bleomycin Hydrolase (BLMH) Antibody (FITC)
20-abx273637	Abbexa	EUR 481.00 EUR 244.00 EUR 1414.00 EUR 662.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Bleomycin Hydrolase (BLMH) Antibody (Biotin)
20-abx272261	Abbexa	EUR 453.00 EUR 244.00 EUR 1316.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Bleomycin Hydrolase (BLMH) Antibody (Biotin)
20-abx273337	Abbexa	EUR 481.00 EUR 244.00 EUR 1414.00 EUR 662.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Guinea pig Bleomycin hydrolase(BLMH) ELISA kit
E05B0805-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Bleomycin hydrolase(BLMH) ELISA kit
E05B0805-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Bleomycin hydrolase(BLMH) ELISA kit
E05B0805-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Bleomycin Hydrolase (BLMH) Polyclonal Antibody (Human)
4-PAC220Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: BLMH (Met213~Trp447) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Bleomycin Hydrolase (BLMH)

BLMH Bleomycin Hydrolase Human Recombinant Protein
PROTQ13867	BosterBio	Regular: 20ug	EUR 317
Description: BLMH produced in E.Coli is a single, non-glycosylated polypeptide chain containing 475 amino acids (1-455a.a.) and having a molecular mass of 54.7kDa.;BLMH is fused to a 20 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Blmh ELISA Kit| Rat Bleomycin hydrolase ELISA Kit
EF018379	Lifescience Market	96 Tests	EUR 689

BLMH ELISA Kit| chicken Bleomycin hydrolase ELISA Kit
EF012220	Lifescience Market	96 Tests	EUR 689

Blmh ELISA Kit| Mouse Bleomycin hydrolase ELISA Kit
EF014316	Lifescience Market	96 Tests	EUR 689

Bleomycin Hydrolase (BLMH) Polyclonal Antibody (Mouse)
4-PAC220Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: BLMH (Ala27~Cys164) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Bleomycin Hydrolase (BLMH)

Bleomycin Hydrolase (BLMH) Polyclonal Antibody (Rat)
4-PAC220Ra01	Cloud-Clone	EUR 259.00 EUR 2708.00 EUR 670.00 EUR 328.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: BLMH (Val30~Phe165) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Bleomycin Hydrolase (BLMH)

Bleomycin Hydrolase (BLMH) Monoclonal Antibody (Rat)
4-MAC220Ra21	Cloud-Clone	EUR 260.00 EUR 2721.00 EUR 673.00 EUR 329.00 EUR 220.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Val30~Phe165 Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Rat Bleomycin Hydrolase (BLMH)

Bleomycin Hydrolase (BLMH) Polyclonal Antibody (Human), APC
4-PAC220Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: BLMH (Met213~Trp447) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Bleomycin Hydrolase (BLMH). This antibody is labeled with APC.

Bleomycin Hydrolase (BLMH) Polyclonal Antibody (Human), Biotinylated
4-PAC220Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: BLMH (Met213~Trp447) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Bleomycin Hydrolase (BLMH). This antibody is labeled with Biotin.

Bleomycin Hydrolase (BLMH) Polyclonal Antibody (Human), Cy3
4-PAC220Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: BLMH (Met213~Trp447) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Bleomycin Hydrolase (BLMH). This antibody is labeled with Cy3.

Bleomycin Hydrolase (BLMH) Polyclonal Antibody (Human), FITC
4-PAC220Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: BLMH (Met213~Trp447) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Bleomycin Hydrolase (BLMH). This antibody is labeled with FITC.

Bleomycin Hydrolase (BLMH) Polyclonal Antibody (Human), HRP
4-PAC220Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: BLMH (Met213~Trp447) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Bleomycin Hydrolase (BLMH). This antibody is labeled with HRP.

Bleomycin Hydrolase (BLMH) Polyclonal Antibody (Human), PE
4-PAC220Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: BLMH (Met213~Trp447) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Bleomycin Hydrolase (BLMH). This antibody is labeled with PE.

Bleomycin Hydrolase (BLMH) Polyclonal Antibody (Mouse), APC
4-PAC220Mu01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: BLMH (Ala27~Cys164) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Bleomycin Hydrolase (BLMH). This antibody is labeled with APC.

Bleomycin Hydrolase (BLMH) Polyclonal Antibody (Mouse), Biotinylated
4-PAC220Mu01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: BLMH (Ala27~Cys164) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Bleomycin Hydrolase (BLMH). This antibody is labeled with Biotin.

Bleomycin Hydrolase (BLMH) Polyclonal Antibody (Mouse), Cy3
4-PAC220Mu01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: BLMH (Ala27~Cys164) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Bleomycin Hydrolase (BLMH). This antibody is labeled with Cy3.

Bleomycin Hydrolase (BLMH) Polyclonal Antibody (Mouse), FITC
4-PAC220Mu01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: BLMH (Ala27~Cys164) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Bleomycin Hydrolase (BLMH). This antibody is labeled with FITC.

Bleomycin Hydrolase (BLMH) Polyclonal Antibody (Mouse), HRP
4-PAC220Mu01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: BLMH (Ala27~Cys164) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Bleomycin Hydrolase (BLMH). This antibody is labeled with HRP.

Bleomycin Hydrolase (BLMH) Polyclonal Antibody (Mouse), PE
4-PAC220Mu01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: BLMH (Ala27~Cys164) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Bleomycin Hydrolase (BLMH). This antibody is labeled with PE.

Bleomycin Hydrolase (BLMH) Polyclonal Antibody (Rat), APC
4-PAC220Ra01-APC	Cloud-Clone	EUR 364.00 EUR 3545.00 EUR 980.00 EUR 467.00 EUR 227.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: BLMH (Val30~Phe165) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Bleomycin Hydrolase (BLMH). This antibody is labeled with APC.

Bleomycin Hydrolase (BLMH) Polyclonal Antibody (Rat), Biotinylated
4-PAC220Ra01-Biotin	Cloud-Clone	EUR 325.00 EUR 2658.00 EUR 777.00 EUR 400.00 EUR 225.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: BLMH (Val30~Phe165) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Bleomycin Hydrolase (BLMH). This antibody is labeled with Biotin.

Bleomycin Hydrolase (BLMH) Polyclonal Antibody (Rat), Cy3
4-PAC220Ra01-Cy3	Cloud-Clone	EUR 444.00 EUR 4685.00 EUR 1265.00 EUR 581.00 EUR 261.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: BLMH (Val30~Phe165) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Bleomycin Hydrolase (BLMH). This antibody is labeled with Cy3.

Bleomycin Hydrolase (BLMH) Polyclonal Antibody (Rat), FITC
4-PAC220Ra01-FITC	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: BLMH (Val30~Phe165) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Bleomycin Hydrolase (BLMH). This antibody is labeled with FITC.

Bleomycin Hydrolase (BLMH) Polyclonal Antibody (Rat), HRP
4-PAC220Ra01-HRP	Cloud-Clone	EUR 332.00 EUR 3089.00 EUR 866.00 EUR 421.00 EUR 213.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: BLMH (Val30~Phe165) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Bleomycin Hydrolase (BLMH). This antibody is labeled with HRP.

Bleomycin Hydrolase (BLMH) Polyclonal Antibody (Rat), PE
4-PAC220Ra01-PE	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: BLMH (Val30~Phe165) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Bleomycin Hydrolase (BLMH). This antibody is labeled with PE.

Bleomycin Hydrolase (BLMH) Monoclonal Antibody (Rat), APC
4-MAC220Ra21-APC	Cloud-Clone	EUR 365.00 EUR 3563.00 EUR 984.00 EUR 468.00 EUR 228.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Val30~Phe165 Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Rat Bleomycin Hydrolase (BLMH). This antibody is labeled with APC.

Bleomycin Hydrolase (BLMH) Monoclonal Antibody (Rat), Biotinylated
4-MAC220Ra21-Biotin	Cloud-Clone	EUR 326.00 EUR 2671.00 EUR 780.00 EUR 402.00 EUR 225.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Val30~Phe165 Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Rat Bleomycin Hydrolase (BLMH). This antibody is labeled with Biotin.

Bleomycin Hydrolase (BLMH) Monoclonal Antibody (Rat), Cy3
4-MAC220Ra21-Cy3	Cloud-Clone	EUR 445.00 EUR 4709.00 EUR 1271.00 EUR 583.00 EUR 263.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Val30~Phe165 Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Rat Bleomycin Hydrolase (BLMH). This antibody is labeled with Cy3.

Bleomycin Hydrolase (BLMH) Monoclonal Antibody (Rat), FITC
4-MAC220Ra21-FITC	Cloud-Clone	EUR 312.00 EUR 2870.00 EUR 807.00 EUR 395.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Val30~Phe165 Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Rat Bleomycin Hydrolase (BLMH). This antibody is labeled with FITC.

Bleomycin Hydrolase (BLMH) Monoclonal Antibody (Rat), HRP
4-MAC220Ra21-HRP	Cloud-Clone	EUR 333.00 EUR 3104.00 EUR 869.00 EUR 422.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Val30~Phe165 Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Rat Bleomycin Hydrolase (BLMH). This antibody is labeled with HRP.

Bleomycin Hydrolase (BLMH) Monoclonal Antibody (Rat), PE
4-MAC220Ra21-PE	Cloud-Clone	EUR 312.00 EUR 2870.00 EUR 807.00 EUR 395.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Val30~Phe165 Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Rat Bleomycin Hydrolase (BLMH). This antibody is labeled with PE.

Bleomycin Hydrolase (BLMH) Polyclonal Antibody (Human), APC-Cy7
4-PAC220Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: BLMH (Met213~Trp447) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Bleomycin Hydrolase (BLMH). This antibody is labeled with APC-Cy7.

Bleomycin Hydrolase (BLMH) Polyclonal Antibody (Mouse), APC-Cy7
4-PAC220Mu01-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: BLMH (Ala27~Cys164) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Bleomycin Hydrolase (BLMH). This antibody is labeled with APC-Cy7.

Bleomycin Hydrolase (BLMH) Polyclonal Antibody (Rat), APC-Cy7
4-PAC220Ra01-APC-Cy7	Cloud-Clone	EUR 608.00 EUR 6970.00 EUR 1840.00 EUR 814.00 EUR 335.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: BLMH (Val30~Phe165) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Bleomycin Hydrolase (BLMH). This antibody is labeled with APC-Cy7.

Bleomycin Hydrolase (BLMH) Monoclonal Antibody (Rat), APC-Cy7
4-MAC220Ra21-APC-Cy7	Cloud-Clone	EUR 610.00 EUR 7006.00 EUR 1849.00 EUR 817.00 EUR 337.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Val30~Phe165 Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Rat Bleomycin Hydrolase (BLMH). This antibody is labeled with APC-Cy7.

Bleomycin Hydrolase (Recombinant)
20-abx073168	Abbexa	EUR 3418.00 EUR 328.00 EUR 230.00	1 mg 20 ug 5 ug
Shipped within 5-10 working days.

Recombinant Human Bleomycin Hydrolase
7-02527	CHI Scientific	5µg	Ask for price

Recombinant Human Bleomycin Hydrolase
7-02528	CHI Scientific	20µg	Ask for price

Recombinant Human Bleomycin Hydrolase
7-02529	CHI Scientific	1mg	Ask for price

Blmh/ Rat Blmh ELISA Kit
ELI-33363r	Lifescience Market	96 Tests	EUR 886

BLMH ELISA KIT|Human
EF008123	Lifescience Market	96 Tests	EUR 689

BLMH ELISA Kit (Human) (OKCD00313)
OKCD00313	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: The normal physiological role of BLM hydrolase is unknown, but it catalyzes the inactivation of the antitumor drug BLM (a glycopeptide) by hydrolyzing the carboxamide bond of its B-aminoalaninamide moiety thus protecting normal and malignant cells from BLM toxicity.By similarity ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.055 ng/mL

BLMH ELISA Kit (Human) (OKAN06156)
OKAN06156	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: Bleomycin hydrolase (BMH) is a cytoplasmic cysteine peptidase that is highly conserved through evolution; however, the only known activity of the enzyme is metabolic inactivation of the glycopeptide bleomycin (BLM), an essential component of combination chemotherapy regimens for cancer. The protein contains the signature active site residues of the cysteine protease papain superfamily.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.059 ng/mL

BLMH ELISA Kit (Human) (OKDD00151)
OKDD00151	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: ;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.071 ng/mL

Bleomycin
B053-10MG	TOKU-E	10 mg	EUR 224

Bleomycin
B053-50MG	TOKU-E	50 mg	EUR 708

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Human Recombinant BLMH
6392-100	Biovision		EUR 457

Bleomycin (sulfate)
HY-17565	MedChemExpress	50mg	EUR 821

Bleomycin sulfate
GA7621-10MG	Glentham Life Sciences	10 mg	EUR 102

Bleomycin sulfate
GA7621-25MG	Glentham Life Sciences	25 mg	EUR 174

Bleomycin sulfate
GA7621-5MG	Glentham Life Sciences	5 mg	EUR 74

Bleomycin Sulfate
A8331-10	ApexBio	10 mg	EUR 187
Description: Bleomycin sulfate (BLENOXANE®) is a mixture of cytotoxic glycopeptide antibiotics produced by a strain of streptomyces verticillus.

Bleomycin Sulfate
A8331-5.1	ApexBio	10 mM (in 1mL DMSO)	EUR 340
Description: Bleomycin sulfate (BLENOXANE®) is a mixture of cytotoxic glycopeptide antibiotics produced by a strain of streptomyces verticillus.

Bleomycin Sulfate
A8331-50	ApexBio	50 mg	EUR 593
Description: Bleomycin sulfate (BLENOXANE®) is a mixture of cytotoxic glycopeptide antibiotics produced by a strain of streptomyces verticillus.

Bleomycin Sulfate
A8331-S	ApexBio	Evaluation Sample	EUR 81
Description: Bleomycin sulfate (BLENOXANE®) is a mixture of cytotoxic glycopeptide antibiotics produced by a strain of streptomyces verticillus.

Bleomycin sulfate
2246-10	Biovision		EUR 305

Bleomycin sulfate
2246-50	Biovision		EUR 1023

BLMH Chemi-Luminescent ELISA Kit (Human) (OKCD03322)
OKCD03322	Aviva Systems Biology	96 Wells	EUR 988
Description: Description of target: The normal physiological role of BLM hydrolase is unknown, but it catalyzes the inactivation of the antitumor drug BLM (a glycopeptide) by hydrolyzing the carboxamide bond of its B-aminoalaninamide moiety thus protecting normal and malignant cells from BLM toxicity.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.156 ng/mL

BLMH siRNA
20-abx909134	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

BLMH siRNA
20-abx909135	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

BLMH antibody
70R-2880	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal BLMH antibody raised against the middle region of BLMH

BLMH Antibody
35402-100ul	SAB	100ul	EUR 390

BLMH antibody
38988-100ul	SAB	100ul	EUR 252

BLMH antibody
10R-1335	Fitzgerald	100 ug	EUR 512
Description: Mouse monoclonal BLMH antibody

BLMH antibody
70R-16004	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal BLMH antibody

BLMH Antibody
DF12855	Affbiotech	200ul	EUR 304
Description: BLMH Antibody detects endogenous levels of BLMH.

BLMH Antibody
1-CSB-PA002716ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against BLMH. Recognizes BLMH from Human. This antibody is Unconjugated. Tested in the following application: ELISA

BLMH Antibody
1-CSB-PA002716ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against BLMH. Recognizes BLMH from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

BLMH Antibody
1-CSB-PA002716GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against BLMH. Recognizes BLMH from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

pOTB7-BLMH
PVT18564	Lifescience Market	2 ug	EUR 231

anti-BLMH
YF-PA10486	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to BLMH

anti-BLMH
YF-PA23303	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to BLMH

Human BLMH shRNA Plasmid
20-abx950438	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

BLMH Recombinant Protein (Human)
RP003082	ABM	100 ug	Ask for price

Bleomycin A5 hydrochloride
B004-10MG	TOKU-E	10 mg	EUR 188

Bleomycin A5 hydrochloride
B004-50MG	TOKU-E	50 mg	EUR 397

Bleomycin sulfate USP
B005-10MG	TOKU-E	10 mg	EUR 210

Bleomycin sulfate USP
B005-50MG	TOKU-E	50 mg	EUR 575

Bleomycin A5 (hydrochloride)
C3370-10	ApexBio	10 mg	EUR 328
Description: Bleomycin A5 is an anticancer chemotherapeutic that binds DNA and induces DNA cleavage and strand breaks, it is highly toxic. Additionally, this compound induces apoptosis, alters cell cycle regulation, inhibits proliferation, and decreases tumor size in cellular and animal models of hemangioma.

Bleomycin A5 (hydrochloride)
C3370-25	ApexBio	25 mg	EUR 659
Description: Bleomycin A5 is an anticancer chemotherapeutic that binds DNA and induces DNA cleavage and strand breaks, it is highly toxic. Additionally, this compound induces apoptosis, alters cell cycle regulation, inhibits proliferation, and decreases tumor size in cellular and animal models of hemangioma.

Bleomycin A5 (hydrochloride)
C3370-5	ApexBio	5 mg	EUR 206
Description: Bleomycin A5 is an anticancer chemotherapeutic that binds DNA and induces DNA cleavage and strand breaks, it is highly toxic. Additionally, this compound induces apoptosis, alters cell cycle regulation, inhibits proliferation, and decreases tumor size in cellular and animal models of hemangioma.

BLMH Conjugated Antibody
C38988	SAB	100ul	EUR 397

BLMH cloning plasmid
CSB-CL002716HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1368 Sequence: atgagcagctcgggactgaattcggagaaggtagctgctctgatacagaaactgaattccgacccccagttcgtacttgcccagaatgtcgggaccacccacgacctgctggacatctgtctgaagcgggccacggtgcagcgcgcgcagcatgtgttccagcacgccgtgcccc Show more
Description: A cloning plasmid for the BLMH gene.

anti- BLMH antibody
FNab00907	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:200 IF: 1:20 - 1:50 Immunogen: bleomycin hydrolase Uniprot ID: Q13867 Gene ID: 642 Research Area: Cardiovascular, Metabolism
Description: Antibody raised against BLMH

BLMH Rabbit pAb
A6535-100ul	Abclonal	100 ul	EUR 308

BLMH Rabbit pAb
A6535-200ul	Abclonal	200 ul	EUR 459

BLMH Rabbit pAb
A6535-20ul	Abclonal	20 ul	EUR 183

BLMH Rabbit pAb
A6535-50ul	Abclonal	50 ul	EUR 223

BLMH Blocking Peptide
33R-2825	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of BLMH antibody, catalog no. 70R-2880

BLMH Blocking Peptide
DF12855-BP	Affbiotech	1mg	EUR 195

Anti-BLMH antibody
PAab00907	Lifescience Market	100 ug	EUR 355

Anti-BLMH antibody
STJ28618	St John's Laboratory	100 µl	EUR 277
Description: Bleomycin hydrolase (BMH) is a cytoplasmic cysteine peptidase that is highly conserved through evolution; however, the only known activity of the enzyme is metabolic inactivation of the glycopeptide bleomycin (BLM), an essential component of combination chemotherapy regimens for cancer. The protein contains the signature active site residues of the cysteine protease papain superfamily.

Anti-BLMH (4A2)
YF-MA10095	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to BLMH

Human Acyloxyacyl hydrolase(AOAH) ELISA kit
E01A1552-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Acyloxyacyl hydrolase(AOAH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Acyloxyacyl hydrolase(AOAH) ELISA kit
E01A1552-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Acyloxyacyl hydrolase(AOAH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Acyloxyacyl hydrolase(AOAH) ELISA kit
E01A1552-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Acyloxyacyl hydrolase(AOAH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human γ Glutamate Hydrolase ELISA kit
E01G0559-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human γ Glutamate Hydrolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human γ Glutamate Hydrolase ELISA kit
E01G0559-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human γ Glutamate Hydrolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human γ Glutamate Hydrolase ELISA kit
E01G0559-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human γ Glutamate Hydrolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Hydroxyacylglutathione hydrolase, Mitochondrial ELISA kit
E01H0015-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Hydroxyacylglutathione hydrolase, Mitochondrial in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Hydroxyacylglutathione hydrolase, Mitochondrial ELISA kit
E01H0015-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Hydroxyacylglutathione hydrolase, Mitochondrial in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Hydroxyacylglutathione hydrolase, Mitochondrial ELISA kit
E01H0015-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Hydroxyacylglutathione hydrolase, Mitochondrial in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human HAGH(Hydroxyacylglutathione Hydrolase) ELISA Kit
EH3210	FN Test	96T	EUR 524.1
Detection range: 0.313-20 ng/ml Uniprot ID: Q16775 Alias: HAGH/GLX2/HAGH/GLO2hydroxyacyl glutathione hydrolase/Glx II/GLXII/Glyoxalase II/HAGH1GLX2/hydroxyacylglutathione hydrolase/hydroxyacylglutathione hydrolase, mitochondrial/hydroxyacylglutathion Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human Valacyclovir hydrolase, BPHL ELISA KIT
ELI-11153h	Lifescience Market	96 Tests	EUR 824

Human Acyloxyacyl hydrolase, AOAH ELISA KIT
ELI-34429h	Lifescience Market	96 Tests	EUR 824

Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit
20-abx150541	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Fumarylacetoacetate Hydrolase (FAH) ELISA Kit
20-abx151482	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Valacyclovir Hydrolase (BPHL) ELISA Kit
20-abx386067	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-12 working days.

Human Hydroxyacylglutathione Hydrolase (HAGH) ELISA Kit
abx252611-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Acyloxyacyl Hydrolase (AOAH)ELISA Kit
201-12-2818	SunredBio	96 tests	EUR 440
This Acyloxyacyl Hydrolase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit
DLR-AOAH-Hu-48T	DL Develop	48T	EUR 517
Should the Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Acyloxyacyl Hydrolase (AOAH) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit
DLR-AOAH-Hu-96T	DL Develop	96T	EUR 673
Should the Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Acyloxyacyl Hydrolase (AOAH) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Human Acyloxyacyl hydrolase(AOAH) ELISA kit
CSB-EL001853HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Acyloxyacyl hydrolase (AOAH) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Acyloxyacyl hydrolase(AOAH) ELISA kit
1-CSB-EL001853HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Acyloxyacyl hydrolase(AOAH) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Fumarylacetoacetate Hydrolase ELISA Kit (FAH)
RK01355	Abclonal	96 Tests	EUR 521

Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit
RD-AOAH-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit
RD-AOAH-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit
RDR-AOAH-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit
RDR-AOAH-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Hydroxyacylglutathione Hydrolase(HAGH)ELISA Kit
QY-E01881	Qayee Biotechnology	96T	EUR 361

Human Fumarylacetoacetate Hydrolase(FAH)ELISA Kit
QY-E00564	Qayee Biotechnology	96T	EUR 361

Human Acyloxyacyl Hydrolase(AOAH)ELISA Kit
QY-E00892	Qayee Biotechnology	96T	EUR 361

Human Fumarylacetoacetate Hydrolase (FAH) ELISA Kit
SEJ123Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fumarylacetoacetate Hydrolase (FAH) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fumarylacetoacetate Hydrolase (FAH) in serum, plasma, tissue homogenates and other biological fluids.

Human Fumarylacetoacetate Hydrolase (FAH) ELISA Kit
SEJ123Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fumarylacetoacetate Hydrolase (FAH) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fumarylacetoacetate Hydrolase (FAH) in serum, plasma, tissue homogenates and other biological fluids.

Human Fumarylacetoacetate Hydrolase (FAH) ELISA Kit
SEJ123Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fumarylacetoacetate Hydrolase (FAH) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fumarylacetoacetate Hydrolase (FAH) in serum, plasma, tissue homogenates and other biological fluids.

Human Fumarylacetoacetate Hydrolase (FAH) ELISA Kit
SEJ123Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fumarylacetoacetate Hydrolase (FAH) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fumarylacetoacetate Hydrolase (FAH) in serum, plasma, tissue homogenates and other biological fluids.

Human Fumarylacetoacetate Hydrolase (FAH) ELISA Kit
4-SEJ123Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Fumarylacetoacetate Hydrolase elisa. Alternative names of the recognized antigen: FAA Fumarylacetoacetase Tyrosinemia 1 Beta-diketonase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Fumarylacetoacetate Hydrolase (FAH) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit
SEJ634Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Acyloxyacyl Hydrolase (AOAH) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Acyloxyacyl Hydrolase (AOAH) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit
SEJ634Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Acyloxyacyl Hydrolase (AOAH) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Acyloxyacyl Hydrolase (AOAH) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit
SEJ634Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Acyloxyacyl Hydrolase (AOAH) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Acyloxyacyl Hydrolase (AOAH) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit
SEJ634Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Acyloxyacyl Hydrolase (AOAH) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Acyloxyacyl Hydrolase (AOAH) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit
4-SEJ634Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Acyloxyacyl Hydrolase elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Acyloxyacyl Hydrolase (AOAH) in samples from serum, plasma, tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

BLMH ORF Vector (Human) (pORF)
ORF001028	ABM	1.0 ug DNA	EUR 95

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

Human S-formylglutathione hydrolase (ESD) ELISA Kit
abx555912-96tests	Abbexa	96 tests	EUR 668
Shipped within 1-3 weeks.

Human Leukotriene A4 Hydrolase (LTA4H) ELISA Kit
abx572445-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Human Epoxide hydrolase 1(EPHX1) ELISA kit
E01E0380-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Epoxide hydrolase 1(EPHX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Epoxide hydrolase 1(EPHX1) ELISA kit
E01E0380-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Epoxide hydrolase 1(EPHX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Epoxide hydrolase 1(EPHX1) ELISA kit
E01E0380-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Epoxide hydrolase 1(EPHX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Epoxide hydrolase 2(EPHX2) ELISA kit
E01E0381-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Epoxide hydrolase 2(EPHX2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human BLMH(Bleomycin Hydrolase) ELISA Kit