Human CLDN11(Claudin 11) ELISA Kit

Human CLDN11(Claudin 11) ELISA Kit

Human Claudin 11 (CLDN11) ELISA Kit

RD-CLDN11-Hu-96Tests 96 Tests
EUR 723

Claudin 11 (CLDN11) ELISA Kit

abx595124-96tests 96 tests
EUR 637
  • Shipped within 1-2 weeks.

Human Claudin 11 (CLDN11)ELISA kit

201-12-2310 96 tests
EUR 440
  • This Claudin 11 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Claudin 11(CLDN11) ELISA kit

E01C0975-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Claudin 11(CLDN11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Claudin 11(CLDN11) ELISA kit

E01C0975-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Claudin 11(CLDN11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Claudin 11(CLDN11) ELISA kit

E01C0975-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Claudin 11(CLDN11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Claudin 11 (CLDN11) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Claudin 11 (CLDN11) ELISA Kit

abx252220-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human CLDN11(Claudin 11) ELISA Kit

EH2836 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: O75508
  • Alias: CLDN11/Oligodendrocyte-specific protein/CLDN11/claudin 11/OSP/OTM/Oligodendrocyte-specific protein/OSP/OTM
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Claudin- 11, CLDN11 ELISA KIT

ELI-25920h 96 Tests
EUR 824

Human Claudin 11(CLDN11)ELISA Kit

QY-E03563 96T
EUR 361

Human Claudin 11 (CLDN11) ELISA Kit

SEF299Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Claudin 11 (CLDN11) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Claudin 11 (CLDN11) in serum, plasma, tissue homogenates and other biological fluids.

Human Claudin 11 (CLDN11) ELISA Kit

SEF299Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Claudin 11 (CLDN11) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Claudin 11 (CLDN11) in serum, plasma, tissue homogenates and other biological fluids.

Human Claudin 11 (CLDN11) ELISA Kit

SEF299Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Claudin 11 (CLDN11) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Claudin 11 (CLDN11) in serum, plasma, tissue homogenates and other biological fluids.

Human Claudin 11 (CLDN11) ELISA Kit

SEF299Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Claudin 11 (CLDN11) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Claudin 11 (CLDN11) in serum, plasma, tissue homogenates and other biological fluids.

Human Claudin 11 (CLDN11) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Claudin 11 elisa. Alternative names of the recognized antigen: OSP
  • OTM
  • Oligodendrocyte Transmembrane Protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Claudin 11 (CLDN11) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Claudin 11 (CLDN11) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Claudin 11 (CLDN11) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Claudin 11 (CLDN11) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Claudin 11 (CLDN11) Antibody

  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Claudin 11 (CLDN11) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Claudin 11 (CLDN11) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Claudin 11 (CLDN11) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Claudin 11 (CLDN11) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Claudin 11 (CLDN11) Antibody

abx231733-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Claudin 11 (CLDN11) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Goat Claudin 11(CLDN11) ELISA kit

E06C0975-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Claudin 11(CLDN11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Claudin 11(CLDN11) ELISA kit

E06C0975-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Claudin 11(CLDN11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Claudin 11(CLDN11) ELISA kit

E06C0975-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Claudin 11(CLDN11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Claudin 11(CLDN11) ELISA kit

E03C0975-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Claudin 11(CLDN11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Claudin 11(CLDN11) ELISA kit

E03C0975-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Claudin 11(CLDN11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Claudin 11(CLDN11) ELISA kit

E03C0975-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Claudin 11(CLDN11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Claudin 11(CLDN11) ELISA kit

E04C0975-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Claudin 11(CLDN11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Claudin 11(CLDN11) ELISA kit

E04C0975-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Claudin 11(CLDN11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Claudin 11(CLDN11) ELISA kit

E04C0975-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Claudin 11(CLDN11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Claudin 11(CLDN11) ELISA kit

E02C0975-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Claudin 11(CLDN11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Claudin 11(CLDN11) ELISA kit

E02C0975-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Claudin 11(CLDN11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Claudin 11(CLDN11) ELISA kit

E02C0975-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Claudin 11(CLDN11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Claudin 11(CLDN11) ELISA kit

E09C0975-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Claudin 11(CLDN11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Claudin 11(CLDN11) ELISA kit

E09C0975-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Claudin 11(CLDN11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Claudin 11(CLDN11) ELISA kit

E09C0975-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Claudin 11(CLDN11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Claudin 11(CLDN11) ELISA kit

E08C0975-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Claudin 11(CLDN11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Claudin 11(CLDN11) ELISA kit

E08C0975-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Claudin 11(CLDN11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Claudin 11(CLDN11) ELISA kit

E08C0975-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Claudin 11(CLDN11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Claudin 11(CLDN11) ELISA kit

E07C0975-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Claudin 11(CLDN11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Claudin 11(CLDN11) ELISA kit

E07C0975-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Claudin 11(CLDN11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Claudin 11(CLDN11) ELISA kit

E07C0975-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Claudin 11(CLDN11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Claudin- 11, Cldn11 ELISA KIT

ELI-10365m 96 Tests
EUR 865

Bovine Claudin- 11, CLDN11 ELISA KIT

ELI-25255b 96 Tests
EUR 928

Monkey Claudin 11 (CLDN11) ELISA Kit

abx359401-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Pig Claudin 11 (CLDN11) ELISA Kit

abx360515-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Chicken Claudin 11 (CLDN11) ELISA Kit

abx355662-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Claudin 11 (CLDN11) ELISA Kit

abx363583-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Claudin 11 (CLDN11) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

ELISA kit for Human CLDN11 (Claudin 11)

E-EL-H0852 1 plate of 96 wells
EUR 534
  • Gentaur's CLDN11 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human CLDN11. Standards or samples are added to the micro ELISA plate wells and combined wit
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human CLDN11 (Claudin 11) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human CLDN11 (Claudin 11)

ELK3559 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Claudin 11 (CLDN11). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Claudin 11 (CL
  • Show more
Description: A sandwich ELISA kit for detection of Claudin 11 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Claudin 11 (CLDN11) CLIA Kit

abx196523-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Claudin 11 (CLDN11) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Guinea pig Claudin 11(CLDN11) ELISA kit

E05C0975-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Claudin 11(CLDN11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Claudin 11(CLDN11) ELISA kit

E05C0975-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Claudin 11(CLDN11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Claudin 11(CLDN11) ELISA kit

E05C0975-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Claudin 11(CLDN11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Claudin 11 (CLDN11) ELISA Kit

abx357666-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Claudin 11 (CLDN11) Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

CLIA kit for Human CLDN11 (Claudin 11)

E-CL-H0591 1 plate of 96 wells
EUR 584
  • Gentaur's CLDN11 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human CLDN11 . Standards or samples are added to the micro CLIA plate wells and combined with
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Human CLDN11 (Claudin 11) in samples from Serum, Plasma, Cell supernatant

Cldn11/ Rat Cldn11 ELISA Kit

ELI-50978r 96 Tests
EUR 886

Claudin 11 antibody

70R-31130 100 ug
EUR 327
Description: Rabbit polyclonal Claudin 11 antibody

Claudin 11 antibody

70R-50162 100 ul
EUR 244
Description: Purified Polyclonal Claudin 11 antibody

Claudin 11 antibody

70R-6144 50 ug
EUR 467
Description: Rabbit polyclonal Claudin 11 antibody

Claudin 11 Antibody

AF0750 200ul
EUR 304
Description: Claudin 11 Antibody detects endogenous levels of Claudin 11.

Claudin 11 Antibody

AF5364 200ul
EUR 304
Description: Claudin 11 Antibody detects endogenous levels of total Claudin 11.

Claudin 11 Antibody

ABF5364 100 ug
EUR 438

Claudin 11 Antibody

ABF0750 100 ug
EUR 438


EF000282 96 Tests
EUR 689

Claudin 11 Colorimetric Cell-Based ELISA Kit

EKC1118 100ul
EUR 572

Claudin 11 Blocking Peptide

33R-9803 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CLDN11 antibody, catalog no. 70R-6144

Claudin-11 Polyclonal Antibody

ABP55451-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human Claudin-11 at AA range: 130-210
  • Applications tips:
Description: A polyclonal antibody for detection of Claudin-11 from Human, Mouse, Rat. This Claudin-11 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human Claudin-11 at AA range: 130-210

Claudin-11 Polyclonal Antibody

ABP55451-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human Claudin-11 at AA range: 130-210
  • Applications tips:
Description: A polyclonal antibody for detection of Claudin-11 from Human, Mouse, Rat. This Claudin-11 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human Claudin-11 at AA range: 130-210

Claudin-11 Polyclonal Antibody

ABP55451-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human Claudin-11 at AA range: 130-210
  • Applications tips:
Description: A polyclonal antibody for detection of Claudin-11 from Human, Mouse, Rat. This Claudin-11 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human Claudin-11 at AA range: 130-210

Claudin 11 Polyclonal Antibody

ABP58170-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human Claudin 11 Antibody protein
  • Applications tips:
Description: A polyclonal antibody for detection of Claudin 11 from Human, Mouse, Rat. This Claudin 11 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human Claudin 11 Antibody protein

Claudin 11 Polyclonal Antibody

ABP58170-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human Claudin 11 Antibody protein
  • Applications tips:
Description: A polyclonal antibody for detection of Claudin 11 from Human, Mouse, Rat. This Claudin 11 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human Claudin 11 Antibody protein

Claudin 11 Polyclonal Antibody

ABP58170-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human Claudin 11 Antibody protein
  • Applications tips:
Description: A polyclonal antibody for detection of Claudin 11 from Human, Mouse, Rat. This Claudin 11 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human Claudin 11 Antibody protein

Claudin 11 Blocking Peptide

AF0750-BP 1mg
EUR 195

Claudin 11 Blocking Peptide

AF5364-BP 1mg
EUR 195

Claudin-11 Polyclonal Antibody

ES6450-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Claudin-11 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Claudin-11 Polyclonal Antibody

ES6450-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Claudin-11 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

anti- Claudin 11 antibody

FNab01733 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • IHC: 1:20-1:200
  • IF: 1:20-1:200
  • Immunogen: claudin 11
  • Uniprot ID: O75508
  • Gene ID: 5010
  • Research Area: Neuroscience, Stem Cells, Developmental biology
Description: Antibody raised against Claudin 11

Anti-Claudin 11 antibody

PAab01733 100 ug
EUR 355

Anti-Claudin-11 antibody

STJ92310 200 µl
EUR 197
Description: Rabbit polyclonal to Claudin-11.

Anti-Claudin 11 antibody

STJ99632 200 µl
EUR 197
Description: Rabbit polyclonal to Claudin 11.

CLDN11 ELISA Kit (Human) (OKCD08767)

OKCD08767 96 Wells
EUR 975
Description: Description of target: CLDN11 belongs to the claudin family of tight junction associated proteins and is a major component of central nervous system myelin that is necessary for normal CNS function. There is growing evidence that the protein determines the permeability between layers of myelin sheaths via focal adhesion and, with its expression highly regulated during development, may play an important role in cellular proliferation and migration. In addition, the protein is a candidate autoantigen in the development of autoimmune demyelinating disease.The protein encoded by this gene belongs to the claudin family of tight junction associated proteins and is a major component of central nervous system myelin that is necessary for normal CNS function. There is growing evidence that the protein determines the permeability between layers of myelin sheaths via focal adhesion and, with its expression highly regulated during development, may play an important role in cellular proliferation and migration. In addition, the protein is a candidate autoantigen in the development of autoimmune demyelinating disease.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.065ng/mL

CLDN11 ELISA Kit (Human) (OKDD00193)

OKDD00193 96 Wells
EUR 975
Description: Description of target: This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. The protein encoded by this gene is a major component of central nervous system (CNS) myelin and plays an important role in regulating proliferation and migration of oligodendrocytes. Mouse studies showed that the gene deficiency results in deafness and loss of the Sertoli cell epithelial phenotype in the testis. This protein is a tight junction protein at the human blood-testis barrier (BTB), and the BTB disruption is related to a dysfunction of this gene. Alternatively spliced transcript variants encoding different isoforms have been identified.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.059 ng/mL

Claudin 11 Colorimetric Cell-Based ELISA Kit (OKAG00614)

OKAG00614 96 Wells
EUR 596
Description: Description of target: ;Species reactivity: Human, Mouse, Rat;Application: ELISA;Assay info: Assay Type: Cell-Based
Subtype: None
Detection Method: Colorimetric 450 nm;Sensitivity:

Anti-Claudin 11 Monoclonal Antibody

M08381 100ug
EUR 397
Description: Rabbit Monoclonal Claudin 11 Antibody. Validated in Flow Cytometry, WB and tested in Human, Mouse, Rat.

Individual Reaction Mix 11

G065-11 200 reactions
EUR 167

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

CLDN11 antibody

70R-16444 50 ul
EUR 435
Description: Rabbit polyclonal CLDN11 antibody

CLDN11 Antibody

32740-100ul 100ul
EUR 252

CLDN11 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CLDN11. Recognizes CLDN11 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF

CLDN11 Antibody

DF7042 200ul
EUR 304
Description: CLDN11 Antibody detects endogenous levels of total CLDN11.

CLDN11 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CLDN11. Recognizes CLDN11 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:15-1:50

CLDN11 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CLDN11. Recognizes CLDN11 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

CLDN11 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CLDN11. Recognizes CLDN11 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CLDN11 Antibody

ABD7042 100 ug
EUR 438

Human CLDN11 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CLDN11 Recombinant Protein (Human)

RP007231 100 ug Ask for price

Human Claudin 1 ELISA kit

E01C0381-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Claudin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Claudin 1 ELISA kit

E01C0381-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Claudin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Claudin 1 ELISA kit

E01C0381-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Claudin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Claudin-1 ELISA kit

E01C0973-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive for quantitative measurement of Human Claudin-1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Claudin-1 ELISA kit

E01C0973-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive for quantitative measurement of Human Claudin-1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Claudin-1 ELISA kit

E01C0973-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive for quantitative measurement of Human Claudin-1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Claudin 18 ELISA KIT|Human

EF008702 96 Tests
EUR 689

Claudin 22 ELISA KIT|Human

EF008703 96 Tests
EUR 689

Claudin 23 ELISA KIT|Human

EF008704 96 Tests
EUR 689

Claudin 7 ELISA KIT|Human

EF008706 96 Tests
EUR 689

Human Interleukin 11,IL-11 ELISA KIT

201-12-0102 96 tests
EUR 440
  • This Interleukin 11 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Kallikrein 11,KLK 11 ELISA Kit

201-12-0783 96 tests
EUR 440
  • This Kallikrein 11 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Interleukin 11, IL-11 ELISA KIT

CSB-E04596h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Interleukin 11, IL-11 in samples from serum, cell culture supernates, urine, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Interleukin 11, IL-11 ELISA KIT

  • EUR 602.00
  • EUR 4238.00
  • EUR 2256.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Interleukin 11, IL-11 in samples from serum, cell culture supernates, urine, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Syntaxin 11 (Syntaxin 11) ELISA Kit

abx259864-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human IL-11(Interleukin 11) ELISA Kit

EH0174 96T
EUR 476.25
  • Detection range: 31.25-2000 pg/ml
  • Uniprot ID: P20809
  • Alias: IL-11(Interleukin 11)
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml

Human Interleukin 11,IL-11 ELISA KIT

CN-03220H1 96T
EUR 434

Human Interleukin 11,IL-11 ELISA KIT

CN-03220H2 48T
EUR 284

Human Kallikrein 11,KLK 11 ELISA Kit

CN-03728H1 96T
EUR 470

Human Kallikrein 11,KLK 11 ELISA Kit

CN-03728H2 48T
EUR 320

Human Kallikrein 11(KLK 11)ELISA Kit

GA-E0799HM-48T 48T
EUR 289

Human Kallikrein 11(KLK 11)ELISA Kit

GA-E0799HM-96T 96T
EUR 466

Human Interleukin 11(IL-11)ELISA Kit

GA-E0141HM-48T 48T
EUR 289

Human Interleukin 11(IL-11)ELISA Kit

GA-E0141HM-96T 96T
EUR 466

Human Interleukin-11 (IL-11) ELISA Kit

LF-EK60040 1×96T
EUR 790

Human Kallikrein 11(KLK 11)ELISA Kit

QY-E02953 96T
EUR 361

Human Interleukin 11(IL-11)ELISA Kit

QY-E04330 96T
EUR 400

CLDN11 Rabbit pAb

A12478-100ul 100 ul
EUR 308

CLDN11 Rabbit pAb

A12478-200ul 200 ul
EUR 459

CLDN11 Rabbit pAb

A12478-20ul 20 ul
EUR 183

CLDN11 Rabbit pAb

A12478-50ul 50 ul
EUR 223

CLDN11 Blocking Peptide

DF7042-BP 1mg
EUR 195

Polyclonal CLDN11 Antibody

APR11592G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CLDN11 . This antibody is tested and proven to work in the following applications:

CLDN11 cloning plasmid

CSB-CL005492HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 624
  • Sequence: atggtggccacgtgcctgcaggtggtgggcttcgtcacgagcttcgtgggctggatcggggtcatcgtgaccacctccaccaatgactgggtggtgacctgcggctacaccatccccacctgccgcaagctggatgagctgggctccaaggggctgtgggccgactgcgtcatggc
  • Show more
Description: A cloning plasmid for the CLDN11 gene.

CLDN11 Rabbit pAb

A2593-100ul 100 ul
EUR 308

CLDN11 Rabbit pAb

A2593-200ul 200 ul
EUR 459

CLDN11 Rabbit pAb

A2593-20ul 20 ul
EUR 183

CLDN11 Rabbit pAb

A2593-50ul 50 ul
EUR 223


PVT13135 2 ug
EUR 391

Anti-CLDN11 antibody

STJ114352 100 µl
EUR 277
Description: This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. The protein encoded by this gene is a major component of central nervous system (CNS) myelin and plays an important role in regulating proliferation and migration of oligodendrocytes. Mouse studies showed that the gene deficiency results in deafness and loss of the Sertoli cell epithelial phenotype in the testis. This protein is a tight junction protein at the human blood-testis barrier (BTB), and the BTB disruption is related to a dysfunction of this gene. Alternatively spliced transcript variants encoding different isoforms have been identified.

Anti-CLDN11 antibody

STJ23156 100 µl
EUR 277
Description: This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. The protein encoded by this gene is a major component of central nervous system (CNS) myelin and plays an important role in regulating proliferation and migration of oligodendrocytes. Mouse studies showed that the gene deficiency results in deafness and loss of the Sertoli cell epithelial phenotype in the testis. This protein is a tight junction protein at the human blood-testis barrier (BTB), and the BTB disruption is related to a dysfunction of this gene. Alternatively spliced transcript variants encoding different isoforms have been identified.

human claudin 14,CLDN14 ELISA Kit

201-12-1879 96 tests
EUR 440
  • This claudin 14 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Claudin 1 (CLDN1)ELISA kit

201-12-2301 96 tests
EUR 440
  • This Claudin 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Claudin 2 (CLDN2)ELISA kit

201-12-2302 96 tests
EUR 440
  • This Claudin 2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Claudin 3 (CLDN3)ELISA kit

201-12-2303 96 tests
EUR 440
  • This Claudin 3 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Claudin 5 (CLDN5)ELISA kit

201-12-2304 96 tests
EUR 440
  • This Claudin 5 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Claudin 6 (CLDN6)ELISA kit

201-12-2305 96 tests
EUR 440
  • This Claudin 6 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Claudin 7 (CLDN7)ELISA kit

201-12-2306 96 tests
EUR 440
  • This Claudin 7 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Claudin 8 (CLDN8)ELISA kit

201-12-2307 96 tests
EUR 440
  • This Claudin 8 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Claudin 9 (CLDN9)ELISA kit

201-12-2308 96 tests
EUR 440
  • This Claudin 9 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Claudin 10 (CLDN10)ELISA kit

201-12-2309 96 tests
EUR 440
  • This Claudin 10 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Claudin 12 (CLDN12)ELISA kit

201-12-2311 96 tests
EUR 440
  • This Claudin 12 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Claudin 15 (CLDN15)ELISA kit

201-12-2312 96 tests
EUR 440
  • This Claudin 15 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Claudin 16 (CLDN16)ELISA kit

201-12-2313 96 tests
EUR 440
  • This Claudin 16 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Claudin 17 (CLDN17)ELISA kit

201-12-2314 96 tests
EUR 440
  • This Claudin 17 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Claudin 19 (CLDN19)ELISA kit

201-12-2315 96 tests
EUR 440
  • This Claudin 19 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Claudin 20 (CLDN20)ELISA kit

201-12-2316 96 tests
EUR 440
  • This Claudin 20 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Claudin 24 (CLDN24)ELISA kit

201-12-2317 96 tests
EUR 440
  • This Claudin 24 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Claudin 22 (CLDN22)ELISA kit

201-12-2318 96 tests
EUR 440
  • This Claudin 22 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Claudin 23 (CLDN23)ELISA kit

201-12-2319 96 tests
EUR 440
  • This Claudin 23 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Claudin 1 (CLDN1) ELISA Kit

DLR-CLDN1-Hu-48T 48T
EUR 517
  • Should the Human Claudin 1 (CLDN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Claudin 1 (CLDN1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Claudin 1 (CLDN1) ELISA Kit

DLR-CLDN1-Hu-96T 96T
EUR 673
  • Should the Human Claudin 1 (CLDN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Claudin 1 (CLDN1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Claudin 3 (CLDN3) ELISA Kit

DLR-CLDN3-Hu-48T 48T
EUR 517
  • Should the Human Claudin 3 (CLDN3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Claudin 3 (CLDN3) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Claudin 3 (CLDN3) ELISA Kit

DLR-CLDN3-Hu-96T 96T
EUR 673
  • Should the Human Claudin 3 (CLDN3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Claudin 3 (CLDN3) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Claudin 4 (CLDN4) ELISA Kit

DLR-CLDN4-Hu-48T 48T
EUR 517
  • Should the Human Claudin 4 (CLDN4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Claudin 4 (CLDN4) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Claudin 4 (CLDN4) ELISA Kit

DLR-CLDN4-Hu-96T 96T
EUR 673
  • Should the Human Claudin 4 (CLDN4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Claudin 4 (CLDN4) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Claudin 5 (CLDN5) ELISA Kit

DLR-CLDN5-Hu-48T 48T
EUR 517
  • Should the Human Claudin 5 (CLDN5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Claudin 5 (CLDN5) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Human Claudin 5 (CLDN5) ELISA Kit

DLR-CLDN5-Hu-96T 96T
EUR 673
  • Should the Human Claudin 5 (CLDN5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Claudin 5 (CLDN5) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Human Claudin 6 (CLDN6) ELISA Kit

DLR-CLDN6-Hu-48T 48T
EUR 554
  • Should the Human Claudin 6 (CLDN6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Claudin 6 (CLDN6) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Claudin 6 (CLDN6) ELISA Kit

DLR-CLDN6-Hu-96T 96T
EUR 725
  • Should the Human Claudin 6 (CLDN6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Claudin 6 (CLDN6) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Claudin 9 (CLDN9) ELISA Kit

DLR-CLDN9-Hu-48T 48T
EUR 554
  • Should the Human Claudin 9 (CLDN9) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Claudin 9 (CLDN9) in samples from tissue homogenates or other biological fluids.

Human Claudin 9 (CLDN9) ELISA Kit

DLR-CLDN9-Hu-96T 96T
EUR 725
  • Should the Human Claudin 9 (CLDN9) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Claudin 9 (CLDN9) in samples from tissue homogenates or other biological fluids.

Human CLDN1/ Claudin-1 ELISA Kit

E0504Hu 1 Kit
EUR 605

Human CLDN2/ Claudin-2 ELISA Kit

E0505Hu 1 Kit
EUR 605

Human CLDN3/ Claudin-3 ELISA Kit

E0506Hu 1 Kit
EUR 605

Human claudin 14,CLDN14 ELISA kit

E01C0969-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human claudin 14,CLDN14 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human claudin 14,CLDN14 ELISA kit

E01C0969-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human claudin 14,CLDN14 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human claudin 14,CLDN14 ELISA kit

E01C0969-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human claudin 14,CLDN14 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Claudin 4 (CLDN4) ELISA kit

E01C0970-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Claudin 4 (CLDN4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Claudin 4 (CLDN4) ELISA kit

E01C0970-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Claudin 4 (CLDN4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Claudin 4 (CLDN4) ELISA kit

E01C0970-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Claudin 4 (CLDN4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Claudin 10(CLDN10) ELISA kit

E01C0974-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Claudin 10(CLDN10) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Claudin 10(CLDN10) ELISA kit

E01C0974-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Claudin 10(CLDN10) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Claudin 10(CLDN10) ELISA kit

E01C0974-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Claudin 10(CLDN10) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Claudin 12(CLDN12) ELISA kit

E01C0976-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Claudin 12(CLDN12) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Claudin 12(CLDN12) ELISA kit

E01C0976-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Claudin 12(CLDN12) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Claudin 12(CLDN12) ELISA kit

E01C0976-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Claudin 12(CLDN12) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Claudin 15(CLDN15) ELISA kit

E01C0978-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Claudin 15(CLDN15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Claudin 15(CLDN15) ELISA kit

E01C0978-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Claudin 15(CLDN15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Claudin 15(CLDN15) ELISA kit

E01C0978-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Claudin 15(CLDN15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Claudin 16(CLDN16) ELISA kit

E01C0979-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Claudin 16(CLDN16) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Claudin 16(CLDN16) ELISA kit

E01C0979-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Claudin 16(CLDN16) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Claudin 16(CLDN16) ELISA kit

E01C0979-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Claudin 16(CLDN16) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Claudin 17(CLDN17) ELISA kit

E01C0980-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Claudin 17(CLDN17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Claudin 17(CLDN17) ELISA kit

E01C0980-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Claudin 17(CLDN17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Claudin 17(CLDN17) ELISA kit

E01C0980-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Claudin 17(CLDN17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Claudin 18(CLDN18) ELISA kit

E01C0981-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Claudin 18(CLDN18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Claudin 18(CLDN18) ELISA kit

E01C0981-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Claudin 18(CLDN18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Claudin 18(CLDN18) ELISA kit

E01C0981-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Claudin 18(CLDN18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Claudin 19(CLDN19) ELISA kit

E01C0982-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Claudin 19(CLDN19) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Claudin 19(CLDN19) ELISA kit

E01C0982-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Claudin 19(CLDN19) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Claudin 19(CLDN19) ELISA kit

E01C0982-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Claudin 19(CLDN19) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Claudin 2(CLDN2) ELISA kit

E01C0983-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Claudin 2(CLDN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Claudin 2(CLDN2) ELISA kit

E01C0983-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Claudin 2(CLDN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Claudin 2(CLDN2) ELISA kit

E01C0983-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Claudin 2(CLDN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CLDN11(Claudin 11) ELISA Kit