Human CST4(Cystatin 4) ELISA Kit

Human CST4(Cystatin 4) ELISA Kit

Human Cystatin 4 (CST4) ELISA Kit

RD-CST4-Hu-96Tests 96 Tests
EUR 723

Human Cystatin 4 (CST4) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Cystatin 4 (CST4)ELISA Kit

201-12-2805 96 tests
EUR 440
  • This Cystatin 4 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Cystatin 4 ELISA Kit (CST4)

RK01201 96 Tests
EUR 521

Human Cystatin 4(CST4)ELISA Kit

QY-E04222 96T
EUR 361

Human Cystatin 4 (CST4) ELISA Kit

SEJ324Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cystatin 4 (CST4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cystatin 4 (CST4) in serum, plasma, saliva, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Cystatin 4 (CST4) ELISA Kit

SEJ324Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cystatin 4 (CST4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cystatin 4 (CST4) in serum, plasma, saliva, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Cystatin 4 (CST4) ELISA Kit

SEJ324Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cystatin 4 (CST4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cystatin 4 (CST4) in serum, plasma, saliva, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Cystatin 4 (CST4) ELISA Kit

SEJ324Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cystatin 4 (CST4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cystatin 4 (CST4) in serum, plasma, saliva, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Cystatin 4 (CST4) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Cystatin 4 elisa. Alternative names of the recognized antigen: Cystatin S
  • Salivary acidic protein 1
  • Cystatin-SA-III
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Cystatin 4 (CST4) in samples from serum, plasma, saliva, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Cystatin 4 (CST4) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Cystatin 4 (CST4) Antibody

  • EUR 342.00
  • EUR 857.00
  • EUR 439.00
  • EUR 154.00
  • EUR 258.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.

Cystatin 4 (CST4) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cystatin 4 (CST4) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Recombinant Cystatin 4 (CST4)

  • EUR 350.88
  • EUR 197.00
  • EUR 1040.80
  • EUR 413.60
  • EUR 727.20
  • EUR 298.00
  • EUR 2452.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P01036
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 15.4kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Cystatin 4 expressed in: E.coli

ELISA kit for Human CST4 (Cystatin 4)

ELK3152 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Cystatin 4 (CST4). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Cystatin 4 (CST4
  • Show more
Description: A sandwich ELISA kit for detection of Cystatin 4 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Cystatin 4 (CST4) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Cystatin 4 (CST4) Protein

  • EUR 495.00
  • EUR 244.00
  • EUR 1414.00
  • EUR 578.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Cystatin 4 (CST4) Antibody (FITC)

  • EUR 481.00
  • EUR 244.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Cystatin 4 (CST4) Antibody Pair

  • EUR 1748.00
  • EUR 1121.00
  • 10 × 96 tests
  • 5 × 96 tests
  • Shipped within 5-7 working days.

Cystatin 4 (CST4) Antibody (Biotin)

  • EUR 453.00
  • EUR 244.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

CST4 Cystatin 4 Human Recombinant Protein

PROTP01036 Regular: 20ug
EUR 317
Description: CST4 Human Recombinant produced in E. coli is a single polypeptide chain containing 145 amino acids (21-141) and having a molecular mass of 16.8kDa.;CST4 is fused to a 24 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Cystatin 4 (CST4) Monoclonal Antibody (Human)

  • EUR 255.00
  • EUR 2642.00
  • EUR 655.00
  • EUR 322.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Ser21~Ala141
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Cystatin 4 (CST4)

Cystatin 4 (CST4) Polyclonal Antibody (Human)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CST4 (Ser21~Ala141)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cystatin 4 (CST4)

Human Cystatin-S (CST4) ELISA Kit

abx570711-96tests 96 tests
EUR 668
  • Shipped within 1-3 weeks.

Human Cystatin S(CST4) ELISA kit

E01C2123-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Cystatin S(CST4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cystatin S(CST4) ELISA kit

E01C2123-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Cystatin S(CST4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cystatin S(CST4) ELISA kit

E01C2123-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Cystatin S(CST4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CST4/ Cystatin-S ELISA Kit

E0583Hu 1 Kit
EUR 605

Human Cystatin- S, CST4 ELISA KIT

ELI-08962h 96 Tests
EUR 824

Cystatin 4 (CST4) Monoclonal Antibody (Human), APC

  • EUR 358.00
  • EUR 3455.00
  • EUR 957.00
  • EUR 458.00
  • EUR 224.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Ser21~Ala141
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Cystatin 4 (CST4). This antibody is labeled with APC.

Cystatin 4 (CST4) Monoclonal Antibody (Human), Biotinylated

  • EUR 320.00
  • EUR 2592.00
  • EUR 760.00
  • EUR 394.00
  • EUR 223.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Ser21~Ala141
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Cystatin 4 (CST4). This antibody is labeled with Biotin.

Cystatin 4 (CST4) Monoclonal Antibody (Human), Cy3

  • EUR 435.00
  • EUR 4565.00
  • EUR 1235.00
  • EUR 569.00
  • EUR 258.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Ser21~Ala141
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Cystatin 4 (CST4). This antibody is labeled with Cy3.

Cystatin 4 (CST4) Monoclonal Antibody (Human), FITC

  • EUR 306.00
  • EUR 2784.00
  • EUR 786.00
  • EUR 386.00
  • EUR 199.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Ser21~Ala141
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Cystatin 4 (CST4). This antibody is labeled with FITC.

Cystatin 4 (CST4) Monoclonal Antibody (Human), HRP

  • EUR 327.00
  • EUR 3011.00
  • EUR 846.00
  • EUR 413.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Ser21~Ala141
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Cystatin 4 (CST4). This antibody is labeled with HRP.

Cystatin 4 (CST4) Monoclonal Antibody (Human), PE

  • EUR 306.00
  • EUR 2784.00
  • EUR 786.00
  • EUR 386.00
  • EUR 199.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Ser21~Ala141
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Cystatin 4 (CST4). This antibody is labeled with PE.

Cystatin 4 (CST4) Polyclonal Antibody (Human), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CST4 (Ser21~Ala141)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cystatin 4 (CST4). This antibody is labeled with APC.

Cystatin 4 (CST4) Polyclonal Antibody (Human), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CST4 (Ser21~Ala141)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cystatin 4 (CST4). This antibody is labeled with Biotin.

Cystatin 4 (CST4) Polyclonal Antibody (Human), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CST4 (Ser21~Ala141)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cystatin 4 (CST4). This antibody is labeled with Cy3.

Cystatin 4 (CST4) Polyclonal Antibody (Human), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CST4 (Ser21~Ala141)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cystatin 4 (CST4). This antibody is labeled with FITC.

Cystatin 4 (CST4) Polyclonal Antibody (Human), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CST4 (Ser21~Ala141)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cystatin 4 (CST4). This antibody is labeled with HRP.

Cystatin 4 (CST4) Polyclonal Antibody (Human), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CST4 (Ser21~Ala141)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cystatin 4 (CST4). This antibody is labeled with PE.

CST4 Human, Cystatin 4 Human Recombinant Protein, sf9

PROTP01036-1 Regular: 10ug
EUR 317
Description: CST4 produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 131 amino acids (21-141 a.a.) and having a molecular mass of 15.4kDa (Migrates at 13.5-18kDa on SDS-PAGE under reducing conditions). 

Human Cystatin-S (CST4) AssayMax ELISA Kit

EC2442-1 96 Well Plate
EUR 417

Rat Cystatin-S (CST4) ELISA Kit

abx556213-96tests 96 tests
EUR 668
  • Shipped within 1-3 weeks.

Goat Cystatin S(CST4) ELISA kit

E06C2123-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Cystatin S(CST4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Cystatin S(CST4) ELISA kit

E06C2123-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Cystatin S(CST4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Cystatin S(CST4) ELISA kit

E06C2123-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Cystatin S(CST4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Cystatin S(CST4) ELISA kit

E02C2123-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Cystatin S(CST4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Cystatin S(CST4) ELISA kit

E02C2123-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Cystatin S(CST4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Cystatin S(CST4) ELISA kit

E02C2123-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Cystatin S(CST4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cystatin S(CST4) ELISA kit

E03C2123-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Cystatin S(CST4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cystatin S(CST4) ELISA kit

E03C2123-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Cystatin S(CST4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cystatin S(CST4) ELISA kit

E03C2123-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Cystatin S(CST4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cystatin S(CST4) ELISA kit

E04C2123-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Cystatin S(CST4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cystatin S(CST4) ELISA kit

E04C2123-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Cystatin S(CST4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cystatin S(CST4) ELISA kit

E04C2123-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Cystatin S(CST4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Cystatin S(CST4) ELISA kit

E08C2123-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Cystatin S(CST4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Cystatin S(CST4) ELISA kit

E08C2123-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Cystatin S(CST4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Cystatin S(CST4) ELISA kit

E08C2123-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Cystatin S(CST4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Cystatin S(CST4) ELISA kit

E09C2123-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Cystatin S(CST4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Cystatin S(CST4) ELISA kit

E09C2123-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Cystatin S(CST4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Cystatin S(CST4) ELISA kit

E09C2123-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Cystatin S(CST4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Cystatin S(CST4) ELISA kit

E07C2123-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Cystatin S(CST4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Cystatin S(CST4) ELISA kit

E07C2123-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Cystatin S(CST4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Cystatin S(CST4) ELISA kit

E07C2123-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Cystatin S(CST4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Cystatin 4 (CST4) Monoclonal Antibody (Human), APC-Cy7

  • EUR 596.00
  • EUR 6790.00
  • EUR 1795.00
  • EUR 796.00
  • EUR 329.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Ser21~Ala141
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Cystatin 4 (CST4). This antibody is labeled with APC-Cy7.

Cystatin 4 (CST4) Polyclonal Antibody (Human), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CST4 (Ser21~Ala141)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cystatin 4 (CST4). This antibody is labeled with APC-Cy7.

Human Cystatin-S (CST4) Antibody

32026-05111 150 ug
EUR 261

Cystatin S (CST4) Antibody

abx145061-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Cystatin S (CST4) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cystatin S (CST4) Antibody

  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cst4 ELISA Kit| Rat Cystatin-S ELISA Kit

EF018524 96 Tests
EUR 689

Guinea pig Cystatin S(CST4) ELISA kit

E05C2123-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Cystatin S(CST4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Cystatin S(CST4) ELISA kit

E05C2123-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Cystatin S(CST4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Cystatin S(CST4) ELISA kit

E05C2123-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Cystatin S(CST4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Cst4/ Rat Cst4 ELISA Kit

ELI-31049r 96 Tests
EUR 886

Recombinant Human Cystatin S/CST4 (C-6His)

C335-10ug 10ug
EUR 131
Description: Lyophilized from a 0.2 μm filtered solution of 20mM MES, 150mM NaCl, pH 5.5.

Recombinant Human Cystatin S/CST4 (C-6His)

C335-1mg 1mg
EUR 2283
Description: Lyophilized from a 0.2 μm filtered solution of 20mM MES, 150mM NaCl, pH 5.5.

Recombinant Human Cystatin S/CST4 (C-6His)

C335-500ug 500ug
EUR 1613
Description: Lyophilized from a 0.2 μm filtered solution of 20mM MES, 150mM NaCl, pH 5.5.

Recombinant Human Cystatin S/CST4 (C-6His)

C335-50ug 50ug
EUR 273
Description: Lyophilized from a 0.2 μm filtered solution of 20mM MES, 150mM NaCl, pH 5.5.

Human Cystatin-S (CST4) Antibody (Biotin Conjugate)

32026-05121 150 ug
EUR 369


EF004811 96 Tests
EUR 689

Human Cystatin-S (CST4) AssayLite Antibody (FITC Conjugate)

32026-05141 150 ug
EUR 428

Human Cystatin-S (CST4) AssayLite Antibody (RPE Conjugate)

32026-05151 150 ug
EUR 428

Human Cystatin-S (CST4) AssayLite Antibody (APC Conjugate)

32026-05161 150 ug
EUR 428

Human Cystatin-S (CST4) AssayLite Antibody (PerCP Conjugate)

32026-05171 150 ug
EUR 471

Cystatin 4 Protein

  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

IL-4 Interleukin 4 Human Recombinant Protein, Yeast

PROTP05112-4 Regular: 10ug
EUR 317
Description: Interleukin-4 Human Recombinant produced in yeast is a single, glycosylated polypeptide chain containing 129 amino acids.;The IL-4 is purified by proprietary chromatographic techniques.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CST4 Antibody

36216-100ul 100ul
EUR 252

CST4 antibody

10R-6877 100 ul
EUR 691
Description: Mouse monoclonal CST4 antibody

CST4 antibody

10R-6878 100 ul
EUR 691
Description: Mouse monoclonal CST4 antibody

CST4 antibody

10R-6879 100 ul
EUR 691
Description: Mouse monoclonal CST4 antibody

CST4 antibody

10R-6880 100 ul
EUR 691
Description: Mouse monoclonal CST4 antibody

CST4 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CST4. Recognizes CST4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

CST4 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CST4. Recognizes CST4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

CST4 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CST4. Recognizes CST4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200

CST3 Mouse, Cystatin-C Mouse Recombinant Protein, Active

PROTP21460-4 Regular: 10ug
EUR 317
Description: CST3 Mouse produced in Sf9 Insect cells is a single, glycosylated polypeptide chain containing 126 amino acids (21-140 a.a.) and having a molecular mass of 14.2kDa (Molecular size on SDS-PAGE will appear at approximately 13.5-18kDa).;CST3 is expressed with a 6 amino acid His tag at C-Terminus and purified by proprietary chromatographic techniques.

Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit

DLR-CA72-4-Hu-48T 48T
EUR 479
  • Should the Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Carbohydrate Antigen 72-4 (CA72-4) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit

DLR-CA72-4-Hu-96T 96T
EUR 621
  • Should the Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Carbohydrate Antigen 72-4 (CA72-4) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit

RD-CA72-4-Hu-48Tests 48 Tests
EUR 478

Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit

RD-CA72-4-Hu-96Tests 96 Tests
EUR 662

Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit

RDR-CA72-4-Hu-48Tests 48 Tests
EUR 500

Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit

RDR-CA72-4-Hu-96Tests 96 Tests
EUR 692

Human CST4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CST4 Recombinant Protein (Human)

RP008224 100 ug Ask for price

Human Cystatin A ELISA kit

E01C0350-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Cystatin A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cystatin A ELISA kit

E01C0350-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Cystatin A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cystatin A ELISA kit

E01C0350-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Cystatin A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cystatin C ELISA kit

E01C0868-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Cystatin C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cystatin C ELISA kit

E01C0868-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Cystatin C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cystatin C ELISA kit

E01C0868-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Cystatin C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Cystatin F ELISA KIT|Human

EF008979 96 Tests
EUR 689

Human Cystatin C ELISA kit

55R-1733 1 kit
EUR 651
Description: ELISA kit for the detection of Cystatin C in the research laboratory

Human Cystatin C ELISA Kit

DEIA2709 96T
EUR 876
Description: For the quantitative determination of human Cystatin C concentrations in cell culture supernates, serum, plasma, saliva, urine, and human milk.

Human Cystatin C ELISA kit

LF-EK50565 1×96T
EUR 648

Human FibrOut 4, for brain, neural

4-21552 1 ml Ask for price

Human FibrOut 4, for brain, neural

4-21553 5 x 1 ml Ask for price

Recombinant Human PF-4 (CXCL4) Protein

PROTP02776-4 20ug
EUR 317
Description: PF-4 is a CXC chemokine that is expressed in megakaryocytes and stored in the α-granules of platelets. PF-4 is chemotactic towards neutrophils and monocytes and has been shown to inhibit angiogenesis. Recombinant human PF-4 is a 7.8 kDa protein containing 70 amino acid residues, including the four highly conserved residues present in CXC chemokines.

Recombinant Human 4-1BB Receptor Protein

PROTQ07011-4 20ug
EUR 317
Description: 4-1BB Receptor, a member of the TNF superfamily of receptors, is mainly expressed on the surface of a variety of T cells, but also found in B cells, monocytes, and various transformed cell lines. 4-1BB Receptor binds to 4-1BBL to provide a co-stimulatory signal for T lymphocytes. Signaling by 4-1BB Receptor has been implicated in the antigen-presentation process and generation of cytotoxic T cells. The human 4-1BB Receptor gene codes for a 255 amino acid type I transmembrane protein containing a 17 amino acid N-terminal signal sequence, a 169 amino acid extracellular domain, a 27 amino acid transmembrane domain and a 42 amino acid cytoplasmic domain. Recombinant human soluble 4-1BB Receptor is a 167 amino acid polypeptide (17.7 kDa), which contains the cysteine rich TNFR-like extracellular domain of 4-1BB Receptor.

CST4 Conjugated Antibody

C36216 100ul
EUR 397

CST4 cloning plasmid

CSB-CL006092HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 426
  • Sequence: atggcccggcctctgtgtaccctgctactcctgatggctaccctggctggggctctggcctcgagctccaaggaggagaataggataatcccaggtggcatctatgatgcagacctcaatgatgagtgggtacagcgtgcccttcacttcgccatcagcgagtacaacaaggccac
  • Show more
Description: A cloning plasmid for the CST4 gene.

CST4 Rabbit pAb

A8114-100ul 100 ul
EUR 308

CST4 Rabbit pAb

A8114-200ul 200 ul
EUR 459

CST4 Rabbit pAb

A8114-20ul 20 ul
EUR 183

CST4 Rabbit pAb

A8114-50ul 50 ul
EUR 223

Anti-CST4 antibody

STJ110413 100 µl
EUR 277
Description: The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. There are three inhibitory families in the superfamily, including the type 1 cystatins (stefins), type 2 cystatins and the kininogens. The type 2 cystatin proteins are a class of cysteine proteinase inhibitors found in a variety of human fluids and secretions. The cystatin locus on chromosome 20 contains the majority of the type 2 cystatin genes and pseudogenes. This gene is located in the cystatin locus and encodes a type 2 salivary cysteine peptidase inhibitor. The protein is an S-type cystatin, based on its high level of expression in saliva, tears and seminal plasma. The specific role in these fluids is unclear but antibacterial and antiviral activity is present, consistent with a protective function.

Human Cystatin D (CST5) ELISA Kit

abx555902-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Cystatin 1 (CST1) ELISA Kit

abx570710-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Human Cystatin A (CSTA) ELISA Kit

abx572078-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Cystatin B (CSTB) ELISA Kit

abx572397-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Cystatin C (CST3) ELISA Kit

abx573769-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Cystatin SN(CST1) ELISA kit

E01C2119-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Cystatin SN(CST1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cystatin SN(CST1) ELISA kit

E01C2119-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Cystatin SN(CST1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cystatin SN(CST1) ELISA kit

E01C2119-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Cystatin SN(CST1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cystatin 11(CST11) ELISA kit

E01C2120-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Cystatin 11(CST11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cystatin 11(CST11) ELISA kit

E01C2120-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Cystatin 11(CST11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cystatin 11(CST11) ELISA kit

E01C2120-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Cystatin 11(CST11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cystatin SA(CST2) ELISA kit

E01C2121-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Cystatin SA(CST2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cystatin SA(CST2) ELISA kit

E01C2121-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Cystatin SA(CST2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cystatin SA(CST2) ELISA kit

E01C2121-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Cystatin SA(CST2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cystatin D(CST5) ELISA kit

E01C2124-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Cystatin D(CST5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cystatin D(CST5) ELISA kit

E01C2124-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Cystatin D(CST5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cystatin D(CST5) ELISA kit

E01C2124-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Cystatin D(CST5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cystatin M(CST6) ELISA kit

E01C2125-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Cystatin M(CST6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cystatin M(CST6) ELISA kit

E01C2125-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Cystatin M(CST6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cystatin M(CST6) ELISA kit

E01C2125-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Cystatin M(CST6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cystatin F(CST7) ELISA kit

E01C2126-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Cystatin F(CST7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cystatin F(CST7) ELISA kit

E01C2126-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Cystatin F(CST7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cystatin F(CST7) ELISA kit

E01C2126-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Cystatin F(CST7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cystatin 8(CST8) ELISA kit

E01C2127-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Cystatin 8(CST8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cystatin 8(CST8) ELISA kit

E01C2127-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Cystatin 8(CST8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cystatin 8(CST8) ELISA kit

E01C2127-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Cystatin 8(CST8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cystatin 9(CST9) ELISA kit

E01C2128-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Cystatin 9(CST9) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cystatin 9(CST9) ELISA kit

E01C2128-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Cystatin 9(CST9) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cystatin 9(CST9) ELISA kit

E01C2128-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Cystatin 9(CST9) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CST3/ Cystatin-C ELISA Kit

E0582Hu 1 Kit
EUR 537

Human CST5/ Cystatin-D ELISA Kit

E0584Hu 1 Kit
EUR 605

Human CST9/ Cystatin-9 ELISA Kit

E0585Hu 1 Kit
EUR 571

Human CSTA/ Cystatin-A ELISA Kit

E0586Hu 1 Kit
EUR 571

ELISA kit for Human Cystatin-A

EK1817 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Cystatin-A in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Cystatin-C

EK2417 96 tests
EUR 452
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Cystatin-C in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Cystatin-D

EK3313 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Cystatin-D in samples from serum, plasma, tissue homogenates and other biological fluids.

Human Cystatin C PicoKine ELISA Kit

EK0678 96 wells
EUR 456
Description: For quantitative detection of Human Cystatin C in cell culture supernates, serum, plasma(heparin, EDTA), saliva, urine and human milk.

Human Cystatin B PicoKine ELISA Kit

EK1205 96 wells
EUR 425
Description: For quantitative detection of human Cystatin B in cell culture supernates, serum, plasma(heparin, EDTA), saliva, urine and human milk.

Human CSTB/ Cystatin-B ELISA Kit

E2763Hu 1 Kit
EUR 537

Cystatin C (CST3) (Human) ELISA Kit

EUR 588

Human CSTB(Cystatin B) ELISA Kit

EH0109 96T
EUR 524.1
  • Detection range: 1.56-100 ng/ml
  • Uniprot ID: P04080
  • Alias: Cystatin B/CSTB/Stefin-B/CPI-B/PME/EPM1/Liver thiol proteinase inhibitor
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.938 ng/ml

Human CST3(Cystatin C) ELISA Kit

EH0110 96T
EUR 476.25
  • Detection range: 0.313-20 ng/ml
  • Uniprot ID: P01034
  • Alias: Cystatin C/CST3/Cys-C/Cystatin 3/ARMD11/Post-Gamma-Globulin
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human CSTA(Cystatin-A) ELISA Kit

EH0919 96T
EUR 524.1
  • Detection range: 0.313-20 ng/ml
  • Uniprot ID: P01040
  • Alias: CSTA/Cystatin-A/Keratolinin/Stefin A//STF1/cystatin A/cystatin AS/Cystatin-AS/STFA/Stefin-A
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human CST9(Cystatin-9) ELISA Kit

EH1567 96T
EUR 567.6
  • Detection range: 78-5000 pg/ml
  • Uniprot ID: Q5W186
  • Alias: CST9/Cystatin-9/Cystatin-like molecule/CLM
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9pg/ml

Human Cystatin- 8, CST8 ELISA KIT

ELI-10130h 96 Tests
EUR 824

Human Cystatin- D, CST5 ELISA KIT

ELI-26473h 96 Tests
EUR 824

Human Cystatin- SN, CST1 ELISA KIT

ELI-26474h 96 Tests
EUR 824

Human Cystatin- C, CST3 ELISA KIT

ELI-03009h 96 Tests
EUR 824

Human Cystatin- 9, CST9 ELISA KIT

ELI-04599h 96 Tests
EUR 824

Human Cystatin- B, CSTB ELISA KIT

ELI-05958h 96 Tests
EUR 824

Human Cystatin- SA, CST2 ELISA KIT

ELI-27041h 96 Tests
EUR 824

Human Cystatin- 11, CST11 ELISA KIT

ELI-32066h 96 Tests
EUR 824

Human Cystatin- F, CST7 ELISA KIT

ELI-50637h 96 Tests
EUR 824

Human Cystatin- M, CST6 ELISA KIT

ELI-50638h 96 Tests
EUR 824

Human Cystatin 1 (CST1) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Cystatin 2 (CST2) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Cystatin 3 (CST3) ELISA Kit

  • EUR 5311.00
  • EUR 2837.00
  • EUR 668.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Cystatin 6 (CST6) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Cystatin A (CSTA) ELISA Kit

  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Cystatin B (CSTB) ELISA Kit

  • EUR 5640.00
  • EUR 3009.00
  • EUR 707.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Cystatin C (CST3) ELISA Kit

abx050049-96tests 96 tests
EUR 770
  • Shipped within 5-10 working days.

Human Cystatin D (CST5) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Cystatin F (CST7) ELISA Kit

abx259522-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Cystatin C (CST3) ELISA Kit

abx350046-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Cystatin 8 (CST8) ELISA Kit

abx386708-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Cystatin 9 (CST9) ELISA Kit

abx250856-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Cystatin A (CSTA) ELISA Kit

abx253875-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Cystatin 1 (CST1)ELISA Kit

201-12-2802 96 tests
EUR 440
  • This Cystatin 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Cystatin 11 (CST11)ELISA Kit

201-12-2803 96 tests
EUR 440
  • This Cystatin 11 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Cystatin 2 (CST2)ELISA Kit

201-12-2804 96 tests
EUR 440
  • This Cystatin 2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Cystatin 5 (CST5)ELISA Kit

201-12-2806 96 tests
EUR 440
  • This Cystatin 5 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Cystatin 6 (CST6)ELISA Kit

201-12-2807 96 tests
EUR 440
  • This Cystatin 6 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Cystatin 7 (CST7)ELISA Kit

201-12-2808 96 tests
EUR 440
  • This Cystatin 7 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Cystatin 8 (CST8)ELISA Kit

201-12-2809 96 tests
EUR 440
  • This Cystatin 8 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Cystatin B (CSTB)ELISA Kit

201-12-2810 96 tests
EUR 440
  • This Cystatin B ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Cystatin 1 (CST1) ELISA Kit

DLR-CST1-Hu-48T 48T
EUR 517
  • Should the Human Cystatin 1 (CST1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Cystatin 1 (CST1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Cystatin 1 (CST1) ELISA Kit

DLR-CST1-Hu-96T 96T
EUR 673
  • Should the Human Cystatin 1 (CST1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Cystatin 1 (CST1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Cystatin 2 (CST2) ELISA Kit

DLR-CST2-Hu-48T 48T
EUR 517
  • Should the Human Cystatin 2 (CST2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Cystatin 2 (CST2) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Cystatin 2 (CST2) ELISA Kit

DLR-CST2-Hu-96T 96T
EUR 673
  • Should the Human Cystatin 2 (CST2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Cystatin 2 (CST2) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Cystatin 3 (CST3) ELISA Kit

DLR-CST3-Hu-48T 48T
EUR 380
  • Should the Human Cystatin 3 (CST3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Cystatin 3 (CST3) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Cystatin 3 (CST3) ELISA Kit

DLR-CST3-Hu-96T 96T
EUR 485
  • Should the Human Cystatin 3 (CST3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Cystatin 3 (CST3) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Cystatin 6 (CST6) ELISA Kit

DLR-CST6-Hu-48T 48T
EUR 517
  • Should the Human Cystatin 6 (CST6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Cystatin 6 (CST6) in samples from serum, plasma, tissue homogenates, sweat, cell culture supernates or other biological fluids.

Human Cystatin 6 (CST6) ELISA Kit

DLR-CST6-Hu-96T 96T
EUR 673
  • Should the Human Cystatin 6 (CST6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Cystatin 6 (CST6) in samples from serum, plasma, tissue homogenates, sweat, cell culture supernates or other biological fluids.

Human Cystatin A (CSTA) ELISA Kit

EUR 479
  • Should the Human Cystatin A (CSTA) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Cystatin A (CSTA) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Cystatin A (CSTA) ELISA Kit

EUR 621
  • Should the Human Cystatin A (CSTA) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Cystatin A (CSTA) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Cystatin B (CSTB) ELISA Kit

EUR 517
  • Should the Human Cystatin B (CSTB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Cystatin B (CSTB) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Cystatin B (CSTB) ELISA Kit

EUR 673
  • Should the Human Cystatin B (CSTB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Cystatin B (CSTB) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human CST4(Cystatin 4) ELISA Kit