Human DCK(Deoxycytidine Kinase) ELISA Kit

Human DCK(Deoxycytidine Kinase) ELISA Kit

Human Deoxycytidine Kinase (DCK) ELISA Kit
RD-DCK-Hu-96Tests 96 Tests
EUR 723

Human Deoxycytidine Kinase (DCK) ELISA Kit
abx571013-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human DCK/ Deoxycytidine kinase ELISA Kit
E0659Hu 1 Kit
EUR 605

Human Deoxycytidine kinase, DCK ELISA KIT
ELI-46760h 96 Tests
EUR 824

Human Deoxycytidine Kinase (DCK) ELISA Kit
20-abx151290
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Deoxycytidine Kinase (DCK) ELISA Kit
SEC440Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Deoxycytidine Kinase (DCK) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Deoxycytidine Kinase (DCK) in Tissue homogenates and other biological fluids.

Human Deoxycytidine Kinase (DCK) ELISA Kit
SEC440Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Deoxycytidine Kinase (DCK) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Deoxycytidine Kinase (DCK) in Tissue homogenates and other biological fluids.

Human Deoxycytidine Kinase (DCK) ELISA Kit
SEC440Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Deoxycytidine Kinase (DCK) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Deoxycytidine Kinase (DCK) in Tissue homogenates and other biological fluids.

Human Deoxycytidine Kinase (DCK) ELISA Kit
SEC440Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Deoxycytidine Kinase (DCK) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Deoxycytidine Kinase (DCK) in Tissue homogenates and other biological fluids.

Human Deoxycytidine Kinase (DCK) ELISA Kit
4-SEC440Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Deoxycytidine Kinase elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Deoxycytidine Kinase (DCK) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Deoxycytidine Kinase (DCK) Antibody
20-abx112038
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Deoxycytidine Kinase (DCK) Antibody
20-abx001486
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Deoxycytidine Kinase (DCK) Antibody
20-abx141632
  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Deoxycytidine Kinase (DCK) Antibody
abx033167-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Deoxycytidine Kinase (DCK) Antibody
abx033167-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Deoxycytidine Kinase (DCK) Antibody
20-abx172085
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Deoxycytidine Kinase (DCK) Antibody
20-abx176140
  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Deoxycytidine Kinase (DCK) Antibody
20-abx214023
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Deoxycytidine Kinase (DCK) Antibody
20-abx301822
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Deoxycytidine Kinase (DCK) Antibody
abx232265-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Cow Deoxycytidine Kinase (DCK) ELISA Kit
abx520844-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Deoxycytidine Kinase (DCK) ELISA Kit
abx520846-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Dck/ Deoxycytidine kinase ELISA Kit
E0285Ra 1 Kit
EUR 646

Mouse Dck/ Deoxycytidine kinase ELISA Kit
E0381Mo 1 Kit
EUR 632

Mouse Deoxycytidine kinase, Dck ELISA KIT
ELI-26521m 96 Tests
EUR 865

Rat Dck(Deoxycytidine kinase) ELISA Kit
ER0690 96T
EUR 567.6
  • Detection range: 0.312-20 ng/ml
  • Uniprot ID: P48769
  • Alias: Dck
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.188 ng/ml

Bovine Deoxycytidine kinase, DCK ELISA KIT
ELI-32398b 96 Tests
EUR 928

Rat Deoxycytidine Kinase (DCK) ELISA Kit
abx256665-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Deoxycytidine Kinase (DCK) Protein
20-abx653154
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Human Deoxycytidine Kinase (DCK) CLIA Kit
20-abx493695
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human DCK (Deoxycytidine Kinase)
ELK3551 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Deoxycytidine Kinase (DCK). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Deoxycy
  • Show more
Description: A sandwich ELISA kit for detection of Deoxycytidine Kinase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Deoxycytidine kinase (DCK)
KTE62132-48T 48T
EUR 332
  • Deoxycytidine kinase (DCK) is required for the phosphorylation of several deoxyribonucleosides and their nucleoside analogs. Deficiency of DCK is associated with resistance to antiviral and anticancer chemotherapeutic agents. Conversely, increased de
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Deoxycytidine kinase (DCK) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Deoxycytidine kinase (DCK)
KTE62132-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Deoxycytidine kinase (DCK) is required for the phosphorylation of several deoxyribonucleosides and their nucleoside analogs. Deficiency of DCK is associated with resistance to antiviral and anticancer chemotherapeutic agents. Conversely, increased de
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Deoxycytidine kinase (DCK) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Deoxycytidine kinase (DCK)
KTE62132-96T 96T
EUR 539
  • Deoxycytidine kinase (DCK) is required for the phosphorylation of several deoxyribonucleosides and their nucleoside analogs. Deficiency of DCK is associated with resistance to antiviral and anticancer chemotherapeutic agents. Conversely, increased de
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Deoxycytidine kinase (DCK) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Polyclonal DCK / Deoxycytidine kinase Antibody
APR03337G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DCK / Deoxycytidine kinase . This antibody is tested and proven to work in the following applications:

Deoxycytidine Kinase (DCK) Antibody (HRP)
20-abx315660
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Deoxycytidine Kinase (DCK) Antibody (FITC)
20-abx315661
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Deoxycytidine Kinase (DCK) Antibody (Biotin)
20-abx315662
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ELISA kit for Mouse Deoxycytidine kinase (DCK)
KTE71329-48T 48T
EUR 332
  • Deoxycytidine kinase (DCK) is required for the phosphorylation of several deoxyribonucleosides and their nucleoside analogs. Deficiency of DCK is associated with resistance to antiviral and anticancer chemotherapeutic agents. Conversely, increased de
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Deoxycytidine kinase (DCK) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Deoxycytidine kinase (DCK)
KTE71329-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Deoxycytidine kinase (DCK) is required for the phosphorylation of several deoxyribonucleosides and their nucleoside analogs. Deficiency of DCK is associated with resistance to antiviral and anticancer chemotherapeutic agents. Conversely, increased de
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Deoxycytidine kinase (DCK) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Deoxycytidine kinase (DCK)
KTE71329-96T 96T
EUR 539
  • Deoxycytidine kinase (DCK) is required for the phosphorylation of several deoxyribonucleosides and their nucleoside analogs. Deficiency of DCK is associated with resistance to antiviral and anticancer chemotherapeutic agents. Conversely, increased de
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Deoxycytidine kinase (DCK) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Deoxycytidine kinase (DCK)
KTE100791-48T 48T
EUR 332
  • Deoxycytidine kinase (DCK) is required for the phosphorylation of several deoxyribonucleosides and their nucleoside analogs. Deficiency of DCK is associated with resistance to antiviral and anticancer chemotherapeutic agents. Conversely, increased de
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Deoxycytidine kinase (DCK) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Deoxycytidine kinase (DCK)
KTE100791-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Deoxycytidine kinase (DCK) is required for the phosphorylation of several deoxyribonucleosides and their nucleoside analogs. Deficiency of DCK is associated with resistance to antiviral and anticancer chemotherapeutic agents. Conversely, increased de
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Deoxycytidine kinase (DCK) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Deoxycytidine kinase (DCK)
KTE100791-96T 96T
EUR 539
  • Deoxycytidine kinase (DCK) is required for the phosphorylation of several deoxyribonucleosides and their nucleoside analogs. Deficiency of DCK is associated with resistance to antiviral and anticancer chemotherapeutic agents. Conversely, increased de
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Deoxycytidine kinase (DCK) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Deoxycytidine kinase (DCK)
KTE10370-48T 48T
EUR 354
  • Deoxycytidine kinase (DCK) is required for the phosphorylation of several deoxyribonucleosides and their nucleoside analogs. Deficiency of DCK is associated with resistance to antiviral and anticancer chemotherapeutic agents. Conversely, increased de
  • Show more
Description: Quantitative sandwich ELISA for measuring Bovine Deoxycytidine kinase (DCK) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Deoxycytidine kinase (DCK)
KTE10370-5platesof96wells 5 plates of 96 wells
EUR 2252
  • Deoxycytidine kinase (DCK) is required for the phosphorylation of several deoxyribonucleosides and their nucleoside analogs. Deficiency of DCK is associated with resistance to antiviral and anticancer chemotherapeutic agents. Conversely, increased de
  • Show more
Description: Quantitative sandwich ELISA for measuring Bovine Deoxycytidine kinase (DCK) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Deoxycytidine kinase (DCK)
KTE10370-96T 96T
EUR 572
  • Deoxycytidine kinase (DCK) is required for the phosphorylation of several deoxyribonucleosides and their nucleoside analogs. Deficiency of DCK is associated with resistance to antiviral and anticancer chemotherapeutic agents. Conversely, increased de
  • Show more
Description: Quantitative sandwich ELISA for measuring Bovine Deoxycytidine kinase (DCK) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Dck ELISA Kit| Mouse Deoxycytidine kinase ELISA Kit
EF014666 96 Tests
EUR 689

Dck ELISA Kit| Rat Deoxycytidine kinase ELISA Kit
EF017503 96 Tests
EUR 689

DCK ELISA Kit| Bovine Deoxycytidine kinase ELISA Kit
EF011302 96 Tests
EUR 689

DCK Deoxycytidine Kinase Human Recombinant Protein
PROTP27707 Regular: 20ug
EUR 317
Description: DCK Human Recombinant fused with a 36 amino acid His tag at N-terminus produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 296 amino acids (1-260 a.a.) and having a molecular mass of 34.6kDa. The DCK is purified by proprietary chromatographic techniques.

Polyclonal DCK / Deoxycytidine kinase Antibody (aa1-260)
APR03299G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DCK / Deoxycytidine kinase (aa1-260). This antibody is tested and proven to work in the following applications:

Recombinant Human Deoxycytidine Kinase/DCK (N-6His, T7 tag)
CF06-10ug 10ug
EUR 146
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl，pH7.5.

Recombinant Human Deoxycytidine Kinase/DCK (N-6His, T7 tag)
CF06-1mg 1mg
EUR 2283
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl，pH7.5.

Recombinant Human Deoxycytidine Kinase/DCK (N-6His, T7 tag)
CF06-500ug 500ug
EUR 1613
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl，pH7.5.

Recombinant Human Deoxycytidine Kinase/DCK (N-6His, T7 tag)
CF06-50ug 50ug
EUR 339
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl，pH7.5.

ELISA kit for Human Deoxycytidine kinase
EK4843 96 tests
EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Deoxycytidine kinase in samples from serum, plasma, tissue homogenates and other biological fluids.

Recombinant Human Deoxycytidine Kinase
7-03913 5µg Ask for price

Recombinant Human Deoxycytidine Kinase
7-03914 20µg Ask for price

Recombinant Human Deoxycytidine Kinase
7-03915 1mg Ask for price

Deoxycytidine kinase antibody
22571-100ul 100ul
EUR 390

ELISA kit for Rat Deoxycytidine kinase
EK4844 96 tests
EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of Rat Deoxycytidine kinase in samples from serum, plasma, tissue homogenates and other biological fluids.

Dck/ Rat Dck ELISA Kit
ELI-46701r 96 Tests
EUR 886

Deoxycytidine Kinase Protein (Recombinant)
20-abx073597
  • EUR 4490.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

DCK ELISA KIT|Human
EF004847 96 Tests
EUR 689

DCK ELISA Kit (Human) (OKCD08132)
OKCD08132 96 Wells
EUR 975
Description: Description of target: Deoxycytidine kinase (DCK) is required for the phosphorylation of several deoxyribonucleosides and their nucleoside analogs. Deficiency of DCK is associated with resistance to antiviral and anticancer chemotherapeutic agents. Conversely, increased deoxycytidine kinase activity is associated with increased activation of these compounds to cytotoxic nucleoside triphosphate derivatives. DCK is clinically important because of its relationship to drug resistance and sensitivity.Deoxycytidine kinase (DCK) is required for the phosphorylation of several deoxyribonucleosides and their nucleoside analogs. Deficiency of DCK is associated with resistance to antiviral and anticancer chemotherapeutic agents. Conversely, increased deoxycytidine kinase activity is associated with increased activation of these compounds to cytotoxic nucleoside triphosphate derivatives. DCK is clinically important because of its relationship to drug resistance and sensitivity. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Entrez Gene record to access additional publications.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.055ng/mL

DCK ELISA Kit (Human) (OKEH03563)
OKEH03563 96 Wells
EUR 727
Description: Description of target: Required for the phosphorylation of the deoxyribonucleosides deoxycytidine (dC), deoxyguanosine (dG) and deoxyadenosine (dA). Has broad substrate specificity, and does not display selectivity based on the chirality of the substrate. It is also an essential enzyme for the phosphorylation of numerous nucleoside analogs widely employed as antiviral and chemotherapeutic agents.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.083 ng/mL

DCK ELISA Kit (Mouse) (OKEH05017)
OKEH05017 96 Wells
EUR 727
Description: Description of target: Required for the phosphorylation of the deoxyribonucleosides deoxycytidine (dC), deoxyguanosine (dG) and deoxyadenosine (dA). ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.084 ng/mL

2-Deoxycytidine
B7862-1000 1 g
EUR 148

Deoxycytidine triphosphate
HY-101400 10mM/1mL
EUR 172

2'-Deoxycytidine
HY-D0184 100mg
EUR 108

2'-Deoxycytidine
GK4440-1G 1 g
EUR 62

2'-Deoxycytidine
GK4440-250MG 250 mg
EUR 46

2'-Deoxycytidine
GK4440-5G 5 g
EUR 134

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1 1
EUR 202

DCK siRNA
20-abx901429
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DCK siRNA
20-abx913665
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DCK siRNA
20-abx913666
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DCK antibody
70R-4406 50 ug
EUR 467
Description: Rabbit polyclonal DCK antibody raised against the middle region of DCK

DCK antibody
70R-3128 50 ug
EUR 467
Description: Rabbit polyclonal DCK antibody raised against the middle region of DCK

DCK Antibody
ABD6620 100 ug
EUR 438

DCK antibody
10R-1380 100 ug
EUR 512
Description: Mouse monoclonal DCK antibody

DCK Antibody
32437-100ul 100ul
EUR 252

DCK antibody
10R-3809 100 ul
EUR 691
Description: Mouse monoclonal DCK antibody

DCK antibody
10R-3810 100 ul
EUR 726
Description: Mouse monoclonal DCK antibody

DCK antibody
10R-3811 100 ul
EUR 691
Description: Mouse monoclonal DCK antibody

DCK antibody
70R-13092 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal DCK antibody

DCK antibody
70R-16754 50 ul
EUR 435
Description: Rabbit polyclonal DCK antibody

DCK Antibody
DF6620 200ul
EUR 304
Description: DCK Antibody detects endogenous levels of total DCK.

DCK Antibody
1-CSB-PA006547GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against DCK. Recognizes DCK from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

DCK Antibody
1-CSB-PA006547LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DCK. Recognizes DCK from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

DCK Antibody
1-CSB-PA283493
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against DCK. Recognizes DCK from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

anti-DCK
YF-PA11293 50 ug
EUR 363
Description: Mouse polyclonal to DCK

anti-DCK
YF-PA11294 50 ul
EUR 363
Description: Mouse polyclonal to DCK

anti-DCK
YF-PA11295 50 ug
EUR 363
Description: Mouse polyclonal to DCK

anti-DCK
YF-PA11296 100 ug
EUR 403
Description: Rabbit polyclonal to DCK

anti-DCK
YF-PA11297 100 ul
EUR 403
Description: Rabbit polyclonal to DCK

anti-DCK
YF-PA11298 100 ug
EUR 403
Description: Rabbit polyclonal to DCK

Human DCK shRNA Plasmid
20-abx951149
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

DCK Recombinant Protein (Human)
RP054264 100 ug Ask for price

2'-Deoxycytidine hydrochloride
B4722-1000 1 g
EUR 203

2'-Deoxycytidine hydrochloride
B4722-5.1 10 mM (in 1mL H2O)
EUR 218

2'-Deoxycytidine (hydrochloride)
HY-17564 500mg
EUR 124

2'-Deoxycytidine hydrochloride
GE7787-1G 1 g
EUR 66

2'-Deoxycytidine hydrochloride
GE7787-25G 25 g
EUR 317

2'-Deoxycytidine hydrochloride
GE7787-5G 5 g
EUR 126

2'-Deoxycytidine hydrochloride
DD0045 1g
EUR 77.84
  • Product category: Biochemicals/Nucleic Acids/Derivatives

DCK ELISA Kit (Rat) : 96 Wells (OKEH01870)
OKEH01870 96 Wells
EUR 727
Description: Description of target: kinase that phosphorylates several deoxyribonucleosides and their nucleoside analogs;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.156 ng/mL

DCK Conjugated Antibody
C32437 100ul
EUR 397

DCK cloning plasmid
CSB-CL006547HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 783
  • Sequence: ATGGCCACCCCGCCCAAGAGAAGCTGCCCGTCTTTCTCAGCCAGCTCTGAGGGGACCCGCATCAAGAAAATCTCCATCGAAGGGAACATCGCTGCAGGGAAGTCAACATTTGTGAATATCCTTAAACAATTGTGTGAAGATTGGGAAGTGGTTCCTGAACCTGTTGCCAGATGGTG
  • Show more
Description: A cloning plasmid for the DCK gene.

anti- DCK antibody
FNab02265 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:200
  • Immunogen: deoxycytidine kinase
  • Uniprot ID: P27707
  • Gene ID: 1633
  • Research Area: Metabolism
Description: Antibody raised against DCK

Anti-DCK Antibody
A01655-1 100ug/vial
EUR 334

DCK Rabbit pAb
A1794-100ul 100 ul
EUR 308

DCK Rabbit pAb
A1794-200ul 200 ul
EUR 459

DCK Rabbit pAb
A1794-20ul 20 ul
EUR 183

DCK Rabbit pAb
A1794-50ul 50 ul
EUR 223

DCK Blocking Peptide
33R-1569 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DCK antibody, catalog no. 70R-4406

DCK Blocking Peptide
33R-7620 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DCK antibody, catalog no. 70R-3128

DCK Blocking Peptide
DF6620-BP 1mg
EUR 195

Anti-DCK antibody
PAab02265 100 ug
EUR 355

Anti-DCK Antibody
STJ500741 100 µg
EUR 476

Anti-DCK antibody
STJ23344 100 µl
EUR 277
Description: Deoxycytidine kinase (DCK) is required for the phosphorylation of several deoxyribonucleosides and their nucleoside analogs. Deficiency of DCK is associated with resistance to antiviral and anticancer chemotherapeutic agents. Conversely, increased deoxycytidine kinase activity is associated with increased activation of these compounds to cytotoxic nucleoside triphosphate derivatives. DCK is clinically important because of its relationship to drug resistance and sensitivity.

Anti-DCK (1E7)
YF-MA12640 100 ug
EUR 363
Description: Mouse monoclonal to DCK

Anti-DCK (1E6)
YF-MA12641 100 ug
EUR 363
Description: Mouse monoclonal to DCK

Anti-DCK (2F10)
YF-MA12642 100 ug
EUR 363
Description: Mouse monoclonal to DCK

Anti-DCK (3E4)
YF-MA12643 100 ug
EUR 363
Description: Mouse monoclonal to DCK

Anti-DCK (3D5)
YF-MA12644 100 ug
EUR 363
Description: Mouse monoclonal to DCK

Anti-DCK (1G6)
YF-MA12645 100 ug
EUR 363
Description: Mouse monoclonal to DCK

Anti-DCK (4H3)
YF-MA12646 100 ug
EUR 363
Description: Mouse monoclonal to DCK

Anti-DCK (1D12)
YF-MA12647 100 ug
EUR 363
Description: Mouse monoclonal to DCK

DCK ORF Vector (Human) (pORF)
ORF018089 1.0 ug DNA
EUR 405

Frit Kit
FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

2-Deoxycytidine 5-monophosphate
B7863-1000 1 g
EUR 148

N4-Acetyl-2'-deoxycytidine
GN3264-10G 10 g
EUR 158

N4-Acetyl-2'-deoxycytidine
GN3264-25G 25 g
EUR 269

5-Aza-2'-deoxycytidine
GP1241-100MG 100 mg
EUR 126

5-Aza-2'-deoxycytidine
GP1241-25MG 25 mg
EUR 70

5-Aza-2'-deoxycytidine
GP1241-5MG 5 mg
EUR 50

5-Methyl-2'-deoxycytidine
GE5158-50MG 50 mg
EUR 75

5-Methyl-2'-deoxycytidine
HY-W012078 10mM/1mL
EUR 113

5-Aza-2'-deoxycytidine
1754-10
EUR 169

5-Aza-2'-deoxycytidine
1754-50
EUR 468

5-Aza-2'-deoxycytidine
M22000 50 mg
EUR 284.9
Description: Ask the seller for details

2'-Deoxycytidine-5'-monophosphoricacid
TWK01261 250mg Ask for price

Column Packing Kit
PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit
M034-Kit Kit
EUR 266

Rat DCK shRNA Plasmid
20-abx986505
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

DCK protein (His tag)
80R-1500 100 ug
EUR 457
Description: Purified recombinant Human DCK protein

Mouse DCK shRNA Plasmid
20-abx969959
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

DCK Antibody, HRP conjugated
1-CSB-PA006547LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DCK. Recognizes DCK from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

DCK Antibody, FITC conjugated
1-CSB-PA006547LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DCK. Recognizes DCK from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

DCK Antibody, Biotin conjugated
1-CSB-PA006547LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DCK. Recognizes DCK from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

DCK Recombinant Protein (Rat)
RP197441 100 ug Ask for price

DCK Recombinant Protein (Mouse)
RP128054 100 ug Ask for price

Anti-DCK Antibody BIOTIN
STJ500742 100 µg
EUR 586

Anti-DCK Antibody FITC
STJ500743 100 µg
EUR 586

DCK sgRNA CRISPR Lentivector set (Human)
K0565501 3 x 1.0 ug
EUR 339

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Global DNA Methylation ELISA Kit (5?-methyl-2?-deoxycytidine Quantitation)
STA-380 96 assays
EUR 624
Description: The Global DNA Methylation ELISA Kit is a competitive ELISA for the quantitative measurement of 5-methylcytosine (5MedCyd). The unknown 5MedCyd samples or 5MedCyd standards are first added to a 5MedCyd DNA conjugate coated EIA plate. After a brief incubation, an anti-5MedCyd monoclonal antibody is added, followed by an HRP conjugated secondary antibody. The 5MedCyd content in unknown samples is determined by comparison with a predetermined 5MedCyd standard curve.

Global DNA Methylation ELISA Kit (5?-methyl-2?-deoxycytidine Quantitation)
STA-380-5 5 x 96 assays
EUR 2503
Description: The Global DNA Methylation ELISA Kit is a competitive ELISA for the quantitative measurement of 5-methylcytosine (5MedCyd). The unknown 5MedCyd samples or 5MedCyd standards are first added to a 5MedCyd DNA conjugate coated EIA plate. After a brief incubation, an anti-5MedCyd monoclonal antibody is added, followed by an HRP conjugated secondary antibody. The 5MedCyd content in unknown samples is determined by comparison with a predetermined 5MedCyd standard curve.

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV200PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV205PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV220PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV225PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS770A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS790A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]
CAS9LIG-KIT 1 Kit
EUR 153
  • Category: Cas9

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

Dck ORF Vector (Rat) (pORF)
ORF065815 1.0 ug DNA
EUR 506

Anti-DCK Antibody (monoclonal, 3G10)
M01655 100ug/vial
EUR 334

Dck ORF Vector (Mouse) (pORF)
ORF042686 1.0 ug DNA
EUR 506

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

DCK sgRNA CRISPR Lentivector (Human) (Target 1)
K0565502 1.0 ug DNA
EUR 154

DCK sgRNA CRISPR Lentivector (Human) (Target 2)
K0565503 1.0 ug DNA
EUR 154

DCK sgRNA CRISPR Lentivector (Human) (Target 3)
K0565504 1.0 ug DNA
EUR 154

DCK Protein Vector (Human) (pPB-C-His)
PV072353 500 ng
EUR 552

DCK Protein Vector (Human) (pPB-N-His)
PV072354 500 ng
EUR 552

DCK Protein Vector (Human) (pPM-C-HA)
PV072355 500 ng
EUR 552

DCK Protein Vector (Human) (pPM-C-His)
PV072356 500 ng
EUR 552

Recombinant Human DCK Protein, His, E.coli-1mg
QP11599-1mg 1mg
EUR 3655

Recombinant Human DCK Protein, His, E.coli-20ug
QP11599-20ug 20ug
EUR 201

Recombinant Human DCK Protein, His, E.coli-5ug
QP11599-5ug 5ug
EUR 155

2'-Fluoro-2'-deoxycytidine-5'-Triphosphate
B7961-.01 10 µl (100 mM)
EUR 142

2'-Fluoro-2'-deoxycytidine-5'-Triphosphate
B7961-.05 50 µl (100 mM)
EUR 308

2'-Fluoro-2'-deoxycytidine-5'-Triphosphate
B7961-.1 100 µl (100 mM)
EUR 518

2'-Fluoro-2'-deoxycytidine-5'-Triphosphate
B7961-.5 5x100 µl (100 mM)
EUR 2059

2'-Fluoro-2'-deoxycytidine-5'-Triphosphate
B7961-1 10 x 100 µl (100 mM)
EUR 2504

2'-Amino-2'-deoxycytidine-5'-Triphosphate
B7979-.01 10 µl (100 mM)
EUR 209

2'-Amino-2'-deoxycytidine-5'-Triphosphate
B7979-.05 50 µl (100 mM)
EUR 799

2'-Amino-2'-deoxycytidine-5'-Triphosphate
B7979-.1 100 µl (100 mM)
EUR 1334

2'-Azido-2'-deoxycytidine-5'-Triphosphate
B7981-.01 10 µl (100 mM)
EUR 209

2'-Azido-2'-deoxycytidine-5'-Triphosphate
B7981-.05 50 µl (100 mM)
EUR 799

2'-Azido-2'-deoxycytidine-5'-Triphosphate
B7981-.1 100 µl (100 mM)
EUR 1334

2'-Deoxycytidine 5'-monophosphate free acid
DB0361 250mg
EUR 84.8
  • Product category: Biochemicals/Nucleic Acids/Derivatives

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE620A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

Human DCK(Deoxycytidine Kinase) ELISA Kit