Human DCK(Deoxycytidine Kinase) ELISA Kit
Human Deoxycytidine Kinase (DCK) ELISA Kit |
RD-DCK-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Deoxycytidine Kinase (DCK) ELISA Kit |
abx571013-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human DCK/ Deoxycytidine kinase ELISA Kit |
E0659Hu |
Sunlong |
1 Kit |
EUR 605 |
Human Deoxycytidine Kinase (DCK) ELISA Kit |
20-abx151290 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Deoxycytidine Kinase (DCK) ELISA Kit |
SEC440Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Deoxycytidine Kinase (DCK) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Deoxycytidine Kinase (DCK) in Tissue homogenates and other biological fluids. |
Human Deoxycytidine Kinase (DCK) ELISA Kit |
SEC440Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Deoxycytidine Kinase (DCK) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Deoxycytidine Kinase (DCK) in Tissue homogenates and other biological fluids. |
Human Deoxycytidine Kinase (DCK) ELISA Kit |
SEC440Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Deoxycytidine Kinase (DCK) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Deoxycytidine Kinase (DCK) in Tissue homogenates and other biological fluids. |
Human Deoxycytidine Kinase (DCK) ELISA Kit |
SEC440Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Deoxycytidine Kinase (DCK) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Deoxycytidine Kinase (DCK) in Tissue homogenates and other biological fluids. |
Human Deoxycytidine Kinase (DCK) ELISA Kit |
4-SEC440Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Deoxycytidine Kinase elisa. Alternative names of the recognized antigen: n/a
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Deoxycytidine Kinase (DCK) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Deoxycytidine Kinase (DCK) Antibody |
20-abx112038 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Deoxycytidine Kinase (DCK) Antibody |
20-abx001486 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Deoxycytidine Kinase (DCK) Antibody |
20-abx141632 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 300.00
|
|
- Shipped within 5-10 working days.
|
Deoxycytidine Kinase (DCK) Antibody |
abx033167-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Deoxycytidine Kinase (DCK) Antibody |
abx033167-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Deoxycytidine Kinase (DCK) Antibody |
20-abx172085 |
Abbexa |
|
|
|
Deoxycytidine Kinase (DCK) Antibody |
20-abx176140 |
Abbexa |
|
|
|
Deoxycytidine Kinase (DCK) Antibody |
20-abx214023 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Deoxycytidine Kinase (DCK) Antibody |
20-abx301822 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Deoxycytidine Kinase (DCK) Antibody |
abx232265-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Cow Deoxycytidine Kinase (DCK) ELISA Kit |
abx520844-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse Deoxycytidine Kinase (DCK) ELISA Kit |
abx520846-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Rat Dck/ Deoxycytidine kinase ELISA Kit |
E0285Ra |
Sunlong |
1 Kit |
EUR 646 |
Mouse Dck/ Deoxycytidine kinase ELISA Kit |
E0381Mo |
Sunlong |
1 Kit |
EUR 632 |
Rat Dck(Deoxycytidine kinase) ELISA Kit |
ER0690 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.312-20 ng/ml
- Uniprot ID: P48769
- Alias: Dck
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.188 ng/ml |
Rat Deoxycytidine Kinase (DCK) ELISA Kit |
abx256665-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Deoxycytidine Kinase (DCK) Protein |
20-abx653154 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Human Deoxycytidine Kinase (DCK) CLIA Kit |
20-abx493695 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
ELISA kit for Human DCK (Deoxycytidine Kinase) |
ELK3551 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Deoxycytidine Kinase (DCK). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Deoxycy
- Show more
|
Description: A sandwich ELISA kit for detection of Deoxycytidine Kinase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Human Deoxycytidine kinase (DCK) |
KTE62132-48T |
Abbkine |
48T |
EUR 332 |
- Deoxycytidine kinase (DCK) is required for the phosphorylation of several deoxyribonucleosides and their nucleoside analogs. Deficiency of DCK is associated with resistance to antiviral and anticancer chemotherapeutic agents. Conversely, increased de
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Deoxycytidine kinase (DCK) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Deoxycytidine kinase (DCK) |
KTE62132-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Deoxycytidine kinase (DCK) is required for the phosphorylation of several deoxyribonucleosides and their nucleoside analogs. Deficiency of DCK is associated with resistance to antiviral and anticancer chemotherapeutic agents. Conversely, increased de
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Deoxycytidine kinase (DCK) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Deoxycytidine kinase (DCK) |
KTE62132-96T |
Abbkine |
96T |
EUR 539 |
- Deoxycytidine kinase (DCK) is required for the phosphorylation of several deoxyribonucleosides and their nucleoside analogs. Deficiency of DCK is associated with resistance to antiviral and anticancer chemotherapeutic agents. Conversely, increased de
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Deoxycytidine kinase (DCK) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Polyclonal DCK / Deoxycytidine kinase Antibody |
APR03337G |
Leading Biology |
0.05ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DCK / Deoxycytidine kinase . This antibody is tested and proven to work in the following applications: |
Deoxycytidine Kinase (DCK) Antibody (HRP) |
20-abx315660 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Deoxycytidine Kinase (DCK) Antibody (FITC) |
20-abx315661 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Deoxycytidine Kinase (DCK) Antibody (Biotin) |
20-abx315662 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
ELISA kit for Mouse Deoxycytidine kinase (DCK) |
KTE71329-48T |
Abbkine |
48T |
EUR 332 |
- Deoxycytidine kinase (DCK) is required for the phosphorylation of several deoxyribonucleosides and their nucleoside analogs. Deficiency of DCK is associated with resistance to antiviral and anticancer chemotherapeutic agents. Conversely, increased de
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Deoxycytidine kinase (DCK) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Deoxycytidine kinase (DCK) |
KTE71329-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Deoxycytidine kinase (DCK) is required for the phosphorylation of several deoxyribonucleosides and their nucleoside analogs. Deficiency of DCK is associated with resistance to antiviral and anticancer chemotherapeutic agents. Conversely, increased de
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Deoxycytidine kinase (DCK) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Deoxycytidine kinase (DCK) |
KTE71329-96T |
Abbkine |
96T |
EUR 539 |
- Deoxycytidine kinase (DCK) is required for the phosphorylation of several deoxyribonucleosides and their nucleoside analogs. Deficiency of DCK is associated with resistance to antiviral and anticancer chemotherapeutic agents. Conversely, increased de
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Deoxycytidine kinase (DCK) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Deoxycytidine kinase (DCK) |
KTE100791-48T |
Abbkine |
48T |
EUR 332 |
- Deoxycytidine kinase (DCK) is required for the phosphorylation of several deoxyribonucleosides and their nucleoside analogs. Deficiency of DCK is associated with resistance to antiviral and anticancer chemotherapeutic agents. Conversely, increased de
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Deoxycytidine kinase (DCK) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Deoxycytidine kinase (DCK) |
KTE100791-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Deoxycytidine kinase (DCK) is required for the phosphorylation of several deoxyribonucleosides and their nucleoside analogs. Deficiency of DCK is associated with resistance to antiviral and anticancer chemotherapeutic agents. Conversely, increased de
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Deoxycytidine kinase (DCK) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Deoxycytidine kinase (DCK) |
KTE100791-96T |
Abbkine |
96T |
EUR 539 |
- Deoxycytidine kinase (DCK) is required for the phosphorylation of several deoxyribonucleosides and their nucleoside analogs. Deficiency of DCK is associated with resistance to antiviral and anticancer chemotherapeutic agents. Conversely, increased de
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Deoxycytidine kinase (DCK) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Bovine Deoxycytidine kinase (DCK) |
KTE10370-48T |
Abbkine |
48T |
EUR 354 |
- Deoxycytidine kinase (DCK) is required for the phosphorylation of several deoxyribonucleosides and their nucleoside analogs. Deficiency of DCK is associated with resistance to antiviral and anticancer chemotherapeutic agents. Conversely, increased de
- Show more
|
Description: Quantitative sandwich ELISA for measuring Bovine Deoxycytidine kinase (DCK) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Bovine Deoxycytidine kinase (DCK) |
KTE10370-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2252 |
- Deoxycytidine kinase (DCK) is required for the phosphorylation of several deoxyribonucleosides and their nucleoside analogs. Deficiency of DCK is associated with resistance to antiviral and anticancer chemotherapeutic agents. Conversely, increased de
- Show more
|
Description: Quantitative sandwich ELISA for measuring Bovine Deoxycytidine kinase (DCK) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Bovine Deoxycytidine kinase (DCK) |
KTE10370-96T |
Abbkine |
96T |
EUR 572 |
- Deoxycytidine kinase (DCK) is required for the phosphorylation of several deoxyribonucleosides and their nucleoside analogs. Deficiency of DCK is associated with resistance to antiviral and anticancer chemotherapeutic agents. Conversely, increased de
- Show more
|
Description: Quantitative sandwich ELISA for measuring Bovine Deoxycytidine kinase (DCK) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Dck ELISA Kit| Mouse Deoxycytidine kinase ELISA Kit |
EF014666 |
Lifescience Market |
96 Tests |
EUR 689 |
Dck ELISA Kit| Rat Deoxycytidine kinase ELISA Kit |
EF017503 |
Lifescience Market |
96 Tests |
EUR 689 |
DCK ELISA Kit| Bovine Deoxycytidine kinase ELISA Kit |
EF011302 |
Lifescience Market |
96 Tests |
EUR 689 |
DCK Deoxycytidine Kinase Human Recombinant Protein |
PROTP27707 |
BosterBio |
Regular: 20ug |
EUR 317 |
Description: DCK Human Recombinant fused with a 36 amino acid His tag at N-terminus produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 296 amino acids (1-260 a.a.) and having a molecular mass of 34.6kDa. The DCK is purified by proprietary chromatographic techniques. |
Polyclonal DCK / Deoxycytidine kinase Antibody (aa1-260) |
APR03299G |
Leading Biology |
0.05ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DCK / Deoxycytidine kinase (aa1-260). This antibody is tested and proven to work in the following applications: |
Recombinant Human Deoxycytidine Kinase/DCK (N-6His, T7 tag) |
CF06-10ug |
Novoprotein |
10ug |
EUR 146 |
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl,pH7.5. |
Recombinant Human Deoxycytidine Kinase/DCK (N-6His, T7 tag) |
CF06-1mg |
Novoprotein |
1mg |
EUR 2283 |
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl,pH7.5. |
Recombinant Human Deoxycytidine Kinase/DCK (N-6His, T7 tag) |
CF06-500ug |
Novoprotein |
500ug |
EUR 1613 |
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl,pH7.5. |
Recombinant Human Deoxycytidine Kinase/DCK (N-6His, T7 tag) |
CF06-50ug |
Novoprotein |
50ug |
EUR 339 |
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl,pH7.5. |
ELISA kit for Human Deoxycytidine kinase |
EK4843 |
SAB |
96 tests |
EUR 603 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Deoxycytidine kinase in samples from serum, plasma, tissue homogenates and other biological fluids. |
Recombinant Human Deoxycytidine Kinase |
7-03913 |
CHI Scientific |
5µg |
Ask for price |
Recombinant Human Deoxycytidine Kinase |
7-03914 |
CHI Scientific |
20µg |
Ask for price |
Recombinant Human Deoxycytidine Kinase |
7-03915 |
CHI Scientific |
1mg |
Ask for price |
Deoxycytidine kinase antibody |
22571-100ul |
SAB |
100ul |
EUR 390 |
ELISA kit for Rat Deoxycytidine kinase |
EK4844 |
SAB |
96 tests |
EUR 603 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Rat Deoxycytidine kinase in samples from serum, plasma, tissue homogenates and other biological fluids. |
Deoxycytidine Kinase Protein (Recombinant) |
20-abx073597 |
Abbexa |
-
EUR 4490.00
-
EUR 328.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
DCK ELISA Kit (Human) (OKCD08132) |
OKCD08132 |
Aviva Systems Biology |
96 Wells |
EUR 975 |
Description: Description of target: Deoxycytidine kinase (DCK) is required for the phosphorylation of several deoxyribonucleosides and their nucleoside analogs. Deficiency of DCK is associated with resistance to antiviral and anticancer chemotherapeutic agents. Conversely, increased deoxycytidine kinase activity is associated with increased activation of these compounds to cytotoxic nucleoside triphosphate derivatives. DCK is clinically important because of its relationship to drug resistance and sensitivity.Deoxycytidine kinase (DCK) is required for the phosphorylation of several deoxyribonucleosides and their nucleoside analogs. Deficiency of DCK is associated with resistance to antiviral and anticancer chemotherapeutic agents. Conversely, increased deoxycytidine kinase activity is associated with increased activation of these compounds to cytotoxic nucleoside triphosphate derivatives. DCK is clinically important because of its relationship to drug resistance and sensitivity. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Entrez Gene record to access additional publications.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.055ng/mL |
DCK ELISA Kit (Human) (OKEH03563) |
OKEH03563 |
Aviva Systems Biology |
96 Wells |
EUR 727 |
Description: Description of target: Required for the phosphorylation of the deoxyribonucleosides deoxycytidine (dC), deoxyguanosine (dG) and deoxyadenosine (dA). Has broad substrate specificity, and does not display selectivity based on the chirality of the substrate. It is also an essential enzyme for the phosphorylation of numerous nucleoside analogs widely employed as antiviral and chemotherapeutic agents.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.083 ng/mL |
DCK ELISA Kit (Mouse) (OKEH05017) |
OKEH05017 |
Aviva Systems Biology |
96 Wells |
EUR 727 |
Description: Description of target: Required for the phosphorylation of the deoxyribonucleosides deoxycytidine (dC), deoxyguanosine (dG) and deoxyadenosine (dA). ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.084 ng/mL |
2-Deoxycytidine |
B7862-1000 |
ApexBio |
1 g |
EUR 148 |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
DCK siRNA |
20-abx901429 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DCK siRNA |
20-abx913665 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DCK siRNA |
20-abx913666 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DCK antibody |
70R-4406 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal DCK antibody raised against the middle region of DCK |
DCK antibody |
70R-3128 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal DCK antibody raised against the middle region of DCK |
DCK antibody |
10R-1380 |
Fitzgerald |
100 ug |
EUR 512 |
Description: Mouse monoclonal DCK antibody |
DCK Antibody |
32437-100ul |
SAB |
100ul |
EUR 252 |
DCK antibody |
10R-3809 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal DCK antibody |
DCK antibody |
10R-3810 |
Fitzgerald |
100 ul |
EUR 726 |
Description: Mouse monoclonal DCK antibody |
DCK antibody |
10R-3811 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal DCK antibody |
DCK antibody |
70R-13092 |
Fitzgerald |
100 ul |
EUR 457 |
Description: Affinity purified Rabbit polyclonal DCK antibody |
DCK antibody |
70R-16754 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal DCK antibody |
DCK Antibody |
DF6620 |
Affbiotech |
200ul |
EUR 304 |
Description: DCK Antibody detects endogenous levels of total DCK. |
DCK Antibody |
1-CSB-PA006547GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against DCK. Recognizes DCK from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
DCK Antibody |
1-CSB-PA006547LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against DCK. Recognizes DCK from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
DCK Antibody |
1-CSB-PA283493 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against DCK. Recognizes DCK from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100 |
anti-DCK |
YF-PA11293 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to DCK |
anti-DCK |
YF-PA11294 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to DCK |
anti-DCK |
YF-PA11295 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to DCK |
anti-DCK |
YF-PA11296 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to DCK |
anti-DCK |
YF-PA11297 |
Abfrontier |
100 ul |
EUR 403 |
Description: Rabbit polyclonal to DCK |
anti-DCK |
YF-PA11298 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to DCK |
Human DCK shRNA Plasmid |
20-abx951149 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
DCK Recombinant Protein (Human) |
RP054264 |
ABM |
100 ug |
Ask for price |
2'-Deoxycytidine hydrochloride |
B4722-1000 |
ApexBio |
1 g |
EUR 203 |
2'-Deoxycytidine hydrochloride |
B4722-5.1 |
ApexBio |
10 mM (in 1mL H2O) |
EUR 218 |
2'-Deoxycytidine (hydrochloride) |
HY-17564 |
MedChemExpress |
500mg |
EUR 124 |
2'-Deoxycytidine hydrochloride |
DD0045 |
Bio Basic |
1g |
EUR 77.84 |
- Product category: Biochemicals/Nucleic Acids/Derivatives
|
DCK ELISA Kit (Rat) : 96 Wells (OKEH01870) |
OKEH01870 |
Aviva Systems Biology |
96 Wells |
EUR 727 |
Description: Description of target: kinase that phosphorylates several deoxyribonucleosides and their nucleoside analogs;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.156 ng/mL |
DCK Conjugated Antibody |
C32437 |
SAB |
100ul |
EUR 397 |
DCK cloning plasmid |
CSB-CL006547HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 783
- Sequence: ATGGCCACCCCGCCCAAGAGAAGCTGCCCGTCTTTCTCAGCCAGCTCTGAGGGGACCCGCATCAAGAAAATCTCCATCGAAGGGAACATCGCTGCAGGGAAGTCAACATTTGTGAATATCCTTAAACAATTGTGTGAAGATTGGGAAGTGGTTCCTGAACCTGTTGCCAGATGGTG
- Show more
|
Description: A cloning plasmid for the DCK gene. |
anti- DCK antibody |
FNab02265 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:500 - 1:2000
- IHC: 1:50 - 1:200
- IF: 1:50 - 1:200
- Immunogen: deoxycytidine kinase
- Uniprot ID: P27707
- Gene ID: 1633
- Research Area: Metabolism
|
Description: Antibody raised against DCK |
Anti-DCK Antibody |
A01655-1 |
BosterBio |
100ug/vial |
EUR 334 |
DCK Rabbit pAb |
A1794-100ul |
Abclonal |
100 ul |
EUR 308 |
DCK Rabbit pAb |
A1794-200ul |
Abclonal |
200 ul |
EUR 459 |
DCK Rabbit pAb |
A1794-20ul |
Abclonal |
20 ul |
EUR 183 |
DCK Rabbit pAb |
A1794-50ul |
Abclonal |
50 ul |
EUR 223 |
DCK Blocking Peptide |
33R-1569 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DCK antibody, catalog no. 70R-4406 |
DCK Blocking Peptide |
33R-7620 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DCK antibody, catalog no. 70R-3128 |
DCK Blocking Peptide |
DF6620-BP |
Affbiotech |
1mg |
EUR 195 |
Anti-DCK antibody |
STJ23344 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: Deoxycytidine kinase (DCK) is required for the phosphorylation of several deoxyribonucleosides and their nucleoside analogs. Deficiency of DCK is associated with resistance to antiviral and anticancer chemotherapeutic agents. Conversely, increased deoxycytidine kinase activity is associated with increased activation of these compounds to cytotoxic nucleoside triphosphate derivatives. DCK is clinically important because of its relationship to drug resistance and sensitivity. |
Anti-DCK (1E7) |
YF-MA12640 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to DCK |
Anti-DCK (1E6) |
YF-MA12641 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to DCK |
Anti-DCK (2F10) |
YF-MA12642 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to DCK |
Anti-DCK (3E4) |
YF-MA12643 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to DCK |
Anti-DCK (3D5) |
YF-MA12644 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to DCK |
Anti-DCK (1G6) |
YF-MA12645 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to DCK |
Anti-DCK (4H3) |
YF-MA12646 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to DCK |
Anti-DCK (1D12) |
YF-MA12647 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to DCK |
DCK ORF Vector (Human) (pORF) |
ORF018089 |
ABM |
1.0 ug DNA |
EUR 405 |
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
2-Deoxycytidine 5-monophosphate |
B7863-1000 |
ApexBio |
1 g |
EUR 148 |
5-Aza-2'-deoxycytidine |
1754-10 |
Biovision |
|
EUR 169 |
5-Aza-2'-deoxycytidine |
1754-50 |
Biovision |
|
EUR 468 |
5-Aza-2'-deoxycytidine |
M22000 |
EpiGentek |
50 mg |
EUR 284.9 |
Description: Ask the seller for details |
2'-Deoxycytidine-5'-monophosphoricacid |
TWK01261 |
ChemNorm |
250mg |
Ask for price |
Column Packing Kit |
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
PCR Mycoplasma Detection Kit |
M034-Kit |
TOKU-E |
Kit |
EUR 266 |
Rat DCK shRNA Plasmid |
20-abx986505 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
DCK protein (His tag) |
80R-1500 |
Fitzgerald |
100 ug |
EUR 457 |
Description: Purified recombinant Human DCK protein |
Mouse DCK shRNA Plasmid |
20-abx969959 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
DCK Antibody, HRP conjugated |
1-CSB-PA006547LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against DCK. Recognizes DCK from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
DCK Antibody, FITC conjugated |
1-CSB-PA006547LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against DCK. Recognizes DCK from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
DCK Antibody, Biotin conjugated |
1-CSB-PA006547LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against DCK. Recognizes DCK from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
DCK Recombinant Protein (Rat) |
RP197441 |
ABM |
100 ug |
Ask for price |
DCK Recombinant Protein (Mouse) |
RP128054 |
ABM |
100 ug |
Ask for price |
DCK sgRNA CRISPR Lentivector set (Human) |
K0565501 |
ABM |
3 x 1.0 ug |
EUR 339 |
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit |
CAS400A-KIT |
SBI |
1 kit (10 rxn) |
EUR 1110 |
|
CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV100PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV105PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV120PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV125PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS700A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS720A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS740A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Global DNA Methylation ELISA Kit (5?-methyl-2?-deoxycytidine Quantitation) |
STA-380 |
Cell Biolabs |
96 assays |
EUR 624 |
Description: The Global DNA Methylation ELISA Kit is a competitive ELISA for the quantitative measurement of 5-methylcytosine (5MedCyd). The unknown 5MedCyd samples or 5MedCyd standards are first added to a 5MedCyd DNA conjugate coated EIA plate. After a brief incubation, an anti-5MedCyd monoclonal antibody is added, followed by an HRP conjugated secondary antibody. The 5MedCyd content in unknown samples is determined by comparison with a predetermined 5MedCyd standard curve. |
Global DNA Methylation ELISA Kit (5?-methyl-2?-deoxycytidine Quantitation) |
STA-380-5 |
Cell Biolabs |
5 x 96 assays |
EUR 2503 |
Description: The Global DNA Methylation ELISA Kit is a competitive ELISA for the quantitative measurement of 5-methylcytosine (5MedCyd). The unknown 5MedCyd samples or 5MedCyd standards are first added to a 5MedCyd DNA conjugate coated EIA plate. After a brief incubation, an anti-5MedCyd monoclonal antibody is added, followed by an HRP conjugated secondary antibody. The 5MedCyd content in unknown samples is determined by comparison with a predetermined 5MedCyd standard curve. |
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents) |
CAS510A-KIT |
SBI |
1 Kit |
EUR 805 |
|
Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV200PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV205PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV220PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV225PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
CAS750A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
CAS770A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
CAS790A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)] |
CAS9LIG-KIT |
SBI |
1 Kit |
EUR 153 |
|
PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN320A-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
Dck ORF Vector (Rat) (pORF) |
ORF065815 |
ABM |
1.0 ug DNA |
EUR 506 |
Anti-DCK Antibody (monoclonal, 3G10) |
M01655 |
BosterBio |
100ug/vial |
EUR 334 |
Dck ORF Vector (Mouse) (pORF) |
ORF042686 |
ABM |
1.0 ug DNA |
EUR 506 |
PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN340iPS-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
DCK sgRNA CRISPR Lentivector (Human) (Target 1) |
K0565502 |
ABM |
1.0 ug DNA |
EUR 154 |
DCK sgRNA CRISPR Lentivector (Human) (Target 2) |
K0565503 |
ABM |
1.0 ug DNA |
EUR 154 |
DCK sgRNA CRISPR Lentivector (Human) (Target 3) |
K0565504 |
ABM |
1.0 ug DNA |
EUR 154 |
DCK Protein Vector (Human) (pPB-C-His) |
PV072353 |
ABM |
500 ng |
EUR 552 |
DCK Protein Vector (Human) (pPB-N-His) |
PV072354 |
ABM |
500 ng |
EUR 552 |
DCK Protein Vector (Human) (pPM-C-HA) |
PV072355 |
ABM |
500 ng |
EUR 552 |
DCK Protein Vector (Human) (pPM-C-His) |
PV072356 |
ABM |
500 ng |
EUR 552 |
Recombinant Human DCK Protein, His, E.coli-1mg |
QP11599-1mg |
EnQuireBio |
1mg |
EUR 3655 |
Recombinant Human DCK Protein, His, E.coli-20ug |
QP11599-20ug |
EnQuireBio |
20ug |
EUR 201 |
Recombinant Human DCK Protein, His, E.coli-5ug |
QP11599-5ug |
EnQuireBio |
5ug |
EUR 155 |
2'-Fluoro-2'-deoxycytidine-5'-Triphosphate |
B7961-.01 |
ApexBio |
10 µl (100 mM) |
EUR 142 |
2'-Fluoro-2'-deoxycytidine-5'-Triphosphate |
B7961-.05 |
ApexBio |
50 µl (100 mM) |
EUR 308 |
2'-Fluoro-2'-deoxycytidine-5'-Triphosphate |
B7961-.1 |
ApexBio |
100 µl (100 mM) |
EUR 518 |
2'-Fluoro-2'-deoxycytidine-5'-Triphosphate |
B7961-.5 |
ApexBio |
5x100 µl (100 mM) |
EUR 2059 |
2'-Fluoro-2'-deoxycytidine-5'-Triphosphate |
B7961-1 |
ApexBio |
10 x 100 µl (100 mM) |
EUR 2504 |
2'-Amino-2'-deoxycytidine-5'-Triphosphate |
B7979-.01 |
ApexBio |
10 µl (100 mM) |
EUR 209 |
2'-Amino-2'-deoxycytidine-5'-Triphosphate |
B7979-.05 |
ApexBio |
50 µl (100 mM) |
EUR 799 |
2'-Amino-2'-deoxycytidine-5'-Triphosphate |
B7979-.1 |
ApexBio |
100 µl (100 mM) |
EUR 1334 |
2'-Azido-2'-deoxycytidine-5'-Triphosphate |
B7981-.01 |
ApexBio |
10 µl (100 mM) |
EUR 209 |
2'-Azido-2'-deoxycytidine-5'-Triphosphate |
B7981-.05 |
ApexBio |
50 µl (100 mM) |
EUR 799 |
2'-Azido-2'-deoxycytidine-5'-Triphosphate |
B7981-.1 |
ApexBio |
100 µl (100 mM) |
EUR 1334 |
2'-Deoxycytidine 5'-monophosphate free acid |
DB0361 |
Bio Basic |
250mg |
EUR 84.8 |
- Product category: Biochemicals/Nucleic Acids/Derivatives
|
AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
GE620A-KIT |
SBI |
1 kit |
EUR 2132 |
|
Human DCK(Deoxycytidine Kinase) ELISA Kit