Human DCK(Deoxycytidine Kinase) ELISA Kit

Notice: Trying to access array offset on value of type bool in /home/fwsoeulh/domains/micca.org/public_html/wp-content/plugins/gentaur-linking/app/Libs/LSPDRequest.php on line 194

Notice: Trying to access array offset on value of type bool in /home/fwsoeulh/domains/micca.org/public_html/wp-content/plugins/gentaur-linking/app/Libs/LSPDRequest.php on line 208

Notice: Trying to access array offset on value of type bool in /home/fwsoeulh/domains/micca.org/public_html/wp-content/plugins/gentaur-linking/app/Libs/LSPDRequest.php on line 229

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/micca.org/public_html/wp-content/plugins/gentaur-linking/vendor_prefixed/pwpf/src/View/View.php on line 103

Human DCK(Deoxycytidine Kinase) ELISA Kit

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/micca.org/public_html/wp-content/plugins/gentaur-linking/vendor_prefixed/pwpf/src/View/View.php on line 64

Human Deoxycytidine Kinase (DCK) ELISA Kit
RD-DCK-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Deoxycytidine Kinase (DCK) ELISA Kit
abx571013-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human DCK/ Deoxycytidine kinase ELISA Kit
E0659Hu	Sunlong	1 Kit	EUR 605

Human Deoxycytidine kinase, DCK ELISA KIT
ELI-46760h	Lifescience Market	96 Tests	EUR 824

Human Deoxycytidine Kinase (DCK) ELISA Kit
20-abx151290	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Deoxycytidine Kinase (DCK) ELISA Kit
SEC440Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Deoxycytidine Kinase (DCK) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Deoxycytidine Kinase (DCK) in Tissue homogenates and other biological fluids.

Human Deoxycytidine Kinase (DCK) ELISA Kit
SEC440Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Deoxycytidine Kinase (DCK) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Deoxycytidine Kinase (DCK) in Tissue homogenates and other biological fluids.

Human Deoxycytidine Kinase (DCK) ELISA Kit
SEC440Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Deoxycytidine Kinase (DCK) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Deoxycytidine Kinase (DCK) in Tissue homogenates and other biological fluids.

Human Deoxycytidine Kinase (DCK) ELISA Kit
SEC440Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Deoxycytidine Kinase (DCK) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Deoxycytidine Kinase (DCK) in Tissue homogenates and other biological fluids.

Human Deoxycytidine Kinase (DCK) ELISA Kit
4-SEC440Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Deoxycytidine Kinase elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Deoxycytidine Kinase (DCK) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Deoxycytidine Kinase (DCK) Antibody
20-abx112038	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Deoxycytidine Kinase (DCK) Antibody
20-abx001486	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Deoxycytidine Kinase (DCK) Antibody
20-abx141632	Abbexa	EUR 370.00 EUR 606.00 EUR 300.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Deoxycytidine Kinase (DCK) Antibody
abx033167-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Deoxycytidine Kinase (DCK) Antibody
abx033167-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Deoxycytidine Kinase (DCK) Antibody
20-abx172085	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Deoxycytidine Kinase (DCK) Antibody
20-abx176140	Abbexa	EUR 1205.00 EUR 578.00	1 mg 200 ug
Please enquire.

Deoxycytidine Kinase (DCK) Antibody
20-abx214023	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Deoxycytidine Kinase (DCK) Antibody
20-abx301822	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Deoxycytidine Kinase (DCK) Antibody
abx232265-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Cow Deoxycytidine Kinase (DCK) ELISA Kit
abx520844-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Deoxycytidine Kinase (DCK) ELISA Kit
abx520846-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Rat Dck/ Deoxycytidine kinase ELISA Kit
E0285Ra	Sunlong	1 Kit	EUR 646

Mouse Dck/ Deoxycytidine kinase ELISA Kit
E0381Mo	Sunlong	1 Kit	EUR 632

Mouse Deoxycytidine kinase, Dck ELISA KIT
ELI-26521m	Lifescience Market	96 Tests	EUR 865

Rat Dck(Deoxycytidine kinase) ELISA Kit
ER0690	FN Test	96T	EUR 567.6
Detection range: 0.312-20 ng/ml Uniprot ID: P48769 Alias: Dck
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.188 ng/ml

Bovine Deoxycytidine kinase, DCK ELISA KIT
ELI-32398b	Lifescience Market	96 Tests	EUR 928

Rat Deoxycytidine Kinase (DCK) ELISA Kit
abx256665-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Deoxycytidine Kinase (DCK) Protein
20-abx653154	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Human Deoxycytidine Kinase (DCK) CLIA Kit
20-abx493695	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Human DCK (Deoxycytidine Kinase)
ELK3551	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Deoxycytidine Kinase (DCK). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Deoxycy Show more
Description: A sandwich ELISA kit for detection of Deoxycytidine Kinase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Deoxycytidine kinase (DCK)
KTE62132-48T	Abbkine	48T	EUR 332
Deoxycytidine kinase (DCK) is required for the phosphorylation of several deoxyribonucleosides and their nucleoside analogs. Deficiency of DCK is associated with resistance to antiviral and anticancer chemotherapeutic agents. Conversely, increased de Show more
Description: Quantitative sandwich ELISA for measuring Human Deoxycytidine kinase (DCK) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Deoxycytidine kinase (DCK)
KTE62132-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Deoxycytidine kinase (DCK) is required for the phosphorylation of several deoxyribonucleosides and their nucleoside analogs. Deficiency of DCK is associated with resistance to antiviral and anticancer chemotherapeutic agents. Conversely, increased de Show more
Description: Quantitative sandwich ELISA for measuring Human Deoxycytidine kinase (DCK) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Deoxycytidine kinase (DCK)
KTE62132-96T	Abbkine	96T	EUR 539
Deoxycytidine kinase (DCK) is required for the phosphorylation of several deoxyribonucleosides and their nucleoside analogs. Deficiency of DCK is associated with resistance to antiviral and anticancer chemotherapeutic agents. Conversely, increased de Show more
Description: Quantitative sandwich ELISA for measuring Human Deoxycytidine kinase (DCK) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Polyclonal DCK / Deoxycytidine kinase Antibody
APR03337G	Leading Biology	0.05ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DCK / Deoxycytidine kinase . This antibody is tested and proven to work in the following applications:

Deoxycytidine Kinase (DCK) Antibody (HRP)
20-abx315660	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Deoxycytidine Kinase (DCK) Antibody (FITC)
20-abx315661	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Deoxycytidine Kinase (DCK) Antibody (Biotin)
20-abx315662	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

ELISA kit for Mouse Deoxycytidine kinase (DCK)
KTE71329-48T	Abbkine	48T	EUR 332
Deoxycytidine kinase (DCK) is required for the phosphorylation of several deoxyribonucleosides and their nucleoside analogs. Deficiency of DCK is associated with resistance to antiviral and anticancer chemotherapeutic agents. Conversely, increased de Show more
Description: Quantitative sandwich ELISA for measuring Mouse Deoxycytidine kinase (DCK) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Deoxycytidine kinase (DCK)
KTE71329-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Deoxycytidine kinase (DCK) is required for the phosphorylation of several deoxyribonucleosides and their nucleoside analogs. Deficiency of DCK is associated with resistance to antiviral and anticancer chemotherapeutic agents. Conversely, increased de Show more
Description: Quantitative sandwich ELISA for measuring Mouse Deoxycytidine kinase (DCK) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Deoxycytidine kinase (DCK)
KTE71329-96T	Abbkine	96T	EUR 539
Deoxycytidine kinase (DCK) is required for the phosphorylation of several deoxyribonucleosides and their nucleoside analogs. Deficiency of DCK is associated with resistance to antiviral and anticancer chemotherapeutic agents. Conversely, increased de Show more
Description: Quantitative sandwich ELISA for measuring Mouse Deoxycytidine kinase (DCK) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Deoxycytidine kinase (DCK)
KTE100791-48T	Abbkine	48T	EUR 332
Deoxycytidine kinase (DCK) is required for the phosphorylation of several deoxyribonucleosides and their nucleoside analogs. Deficiency of DCK is associated with resistance to antiviral and anticancer chemotherapeutic agents. Conversely, increased de Show more
Description: Quantitative sandwich ELISA for measuring Rat Deoxycytidine kinase (DCK) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Deoxycytidine kinase (DCK)
KTE100791-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Deoxycytidine kinase (DCK) is required for the phosphorylation of several deoxyribonucleosides and their nucleoside analogs. Deficiency of DCK is associated with resistance to antiviral and anticancer chemotherapeutic agents. Conversely, increased de Show more
Description: Quantitative sandwich ELISA for measuring Rat Deoxycytidine kinase (DCK) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Deoxycytidine kinase (DCK)
KTE100791-96T	Abbkine	96T	EUR 539
Deoxycytidine kinase (DCK) is required for the phosphorylation of several deoxyribonucleosides and their nucleoside analogs. Deficiency of DCK is associated with resistance to antiviral and anticancer chemotherapeutic agents. Conversely, increased de Show more
Description: Quantitative sandwich ELISA for measuring Rat Deoxycytidine kinase (DCK) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Deoxycytidine kinase (DCK)
KTE10370-48T	Abbkine	48T	EUR 354
Deoxycytidine kinase (DCK) is required for the phosphorylation of several deoxyribonucleosides and their nucleoside analogs. Deficiency of DCK is associated with resistance to antiviral and anticancer chemotherapeutic agents. Conversely, increased de Show more
Description: Quantitative sandwich ELISA for measuring Bovine Deoxycytidine kinase (DCK) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Deoxycytidine kinase (DCK)
KTE10370-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
Deoxycytidine kinase (DCK) is required for the phosphorylation of several deoxyribonucleosides and their nucleoside analogs. Deficiency of DCK is associated with resistance to antiviral and anticancer chemotherapeutic agents. Conversely, increased de Show more
Description: Quantitative sandwich ELISA for measuring Bovine Deoxycytidine kinase (DCK) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Deoxycytidine kinase (DCK)
KTE10370-96T	Abbkine	96T	EUR 572
Deoxycytidine kinase (DCK) is required for the phosphorylation of several deoxyribonucleosides and their nucleoside analogs. Deficiency of DCK is associated with resistance to antiviral and anticancer chemotherapeutic agents. Conversely, increased de Show more
Description: Quantitative sandwich ELISA for measuring Bovine Deoxycytidine kinase (DCK) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Dck ELISA Kit| Mouse Deoxycytidine kinase ELISA Kit
EF014666	Lifescience Market	96 Tests	EUR 689

Dck ELISA Kit| Rat Deoxycytidine kinase ELISA Kit
EF017503	Lifescience Market	96 Tests	EUR 689

DCK ELISA Kit| Bovine Deoxycytidine kinase ELISA Kit
EF011302	Lifescience Market	96 Tests	EUR 689

DCK Deoxycytidine Kinase Human Recombinant Protein
PROTP27707	BosterBio	Regular: 20ug	EUR 317
Description: DCK Human Recombinant fused with a 36 amino acid His tag at N-terminus produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 296 amino acids (1-260 a.a.) and having a molecular mass of 34.6kDa. The DCK is purified by proprietary chromatographic techniques.

Polyclonal DCK / Deoxycytidine kinase Antibody (aa1-260)
APR03299G	Leading Biology	0.05ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DCK / Deoxycytidine kinase (aa1-260). This antibody is tested and proven to work in the following applications:

Recombinant Human Deoxycytidine Kinase/DCK (N-6His, T7 tag)
CF06-10ug	Novoprotein	10ug	EUR 146
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl，pH7.5.

Recombinant Human Deoxycytidine Kinase/DCK (N-6His, T7 tag)
CF06-1mg	Novoprotein	1mg	EUR 2283
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl，pH7.5.

Recombinant Human Deoxycytidine Kinase/DCK (N-6His, T7 tag)
CF06-500ug	Novoprotein	500ug	EUR 1613
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl，pH7.5.

Recombinant Human Deoxycytidine Kinase/DCK (N-6His, T7 tag)
CF06-50ug	Novoprotein	50ug	EUR 339
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl，pH7.5.

ELISA kit for Human Deoxycytidine kinase
EK4843	SAB	96 tests	EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Deoxycytidine kinase in samples from serum, plasma, tissue homogenates and other biological fluids.

Recombinant Human Deoxycytidine Kinase
7-03913	CHI Scientific	5µg	Ask for price

Recombinant Human Deoxycytidine Kinase
7-03914	CHI Scientific	20µg	Ask for price

Recombinant Human Deoxycytidine Kinase
7-03915	CHI Scientific	1mg	Ask for price

Deoxycytidine kinase antibody
22571-100ul	SAB	100ul	EUR 390

ELISA kit for Rat Deoxycytidine kinase
EK4844	SAB	96 tests	EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of Rat Deoxycytidine kinase in samples from serum, plasma, tissue homogenates and other biological fluids.

Dck/ Rat Dck ELISA Kit
ELI-46701r	Lifescience Market	96 Tests	EUR 886

Deoxycytidine Kinase Protein (Recombinant)
20-abx073597	Abbexa	EUR 4490.00 EUR 328.00 EUR 230.00	1 mg 20 ug 5 ug
Shipped within 5-10 working days.

DCK ELISA KIT|Human
EF004847	Lifescience Market	96 Tests	EUR 689

DCK ELISA Kit (Human) (OKCD08132)
OKCD08132	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: Deoxycytidine kinase (DCK) is required for the phosphorylation of several deoxyribonucleosides and their nucleoside analogs. Deficiency of DCK is associated with resistance to antiviral and anticancer chemotherapeutic agents. Conversely, increased deoxycytidine kinase activity is associated with increased activation of these compounds to cytotoxic nucleoside triphosphate derivatives. DCK is clinically important because of its relationship to drug resistance and sensitivity.Deoxycytidine kinase (DCK) is required for the phosphorylation of several deoxyribonucleosides and their nucleoside analogs. Deficiency of DCK is associated with resistance to antiviral and anticancer chemotherapeutic agents. Conversely, increased deoxycytidine kinase activity is associated with increased activation of these compounds to cytotoxic nucleoside triphosphate derivatives. DCK is clinically important because of its relationship to drug resistance and sensitivity. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Entrez Gene record to access additional publications.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.055ng/mL

DCK ELISA Kit (Human) (OKEH03563)
OKEH03563	Aviva Systems Biology	96 Wells	EUR 727
Description: Description of target: Required for the phosphorylation of the deoxyribonucleosides deoxycytidine (dC), deoxyguanosine (dG) and deoxyadenosine (dA). Has broad substrate specificity, and does not display selectivity based on the chirality of the substrate. It is also an essential enzyme for the phosphorylation of numerous nucleoside analogs widely employed as antiviral and chemotherapeutic agents.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.083 ng/mL

DCK ELISA Kit (Mouse) (OKEH05017)
OKEH05017	Aviva Systems Biology	96 Wells	EUR 727
Description: Description of target: Required for the phosphorylation of the deoxyribonucleosides deoxycytidine (dC), deoxyguanosine (dG) and deoxyadenosine (dA). ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.084 ng/mL

2-Deoxycytidine
B7862-1000	ApexBio	1 g	EUR 148

Deoxycytidine triphosphate
HY-101400	MedChemExpress	10mM/1mL	EUR 172

2'-Deoxycytidine
HY-D0184	MedChemExpress	100mg	EUR 108

2'-Deoxycytidine
GK4440-1G	Glentham Life Sciences	1 g	EUR 62

2'-Deoxycytidine
GK4440-250MG	Glentham Life Sciences	250 mg	EUR 46

2'-Deoxycytidine
GK4440-5G	Glentham Life Sciences	5 g	EUR 134

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

DCK siRNA
20-abx901429	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

DCK siRNA
20-abx913665	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

DCK siRNA
20-abx913666	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

DCK antibody
70R-4406	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal DCK antibody raised against the middle region of DCK

DCK antibody
70R-3128	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal DCK antibody raised against the middle region of DCK

DCK Antibody
ABD6620	Lifescience Market	100 ug	EUR 438

DCK antibody
10R-1380	Fitzgerald	100 ug	EUR 512
Description: Mouse monoclonal DCK antibody

DCK Antibody
32437-100ul	SAB	100ul	EUR 252

DCK antibody
10R-3809	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal DCK antibody

DCK antibody
10R-3810	Fitzgerald	100 ul	EUR 726
Description: Mouse monoclonal DCK antibody

DCK antibody
10R-3811	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal DCK antibody

DCK antibody
70R-13092	Fitzgerald	100 ul	EUR 457
Description: Affinity purified Rabbit polyclonal DCK antibody

DCK antibody
70R-16754	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal DCK antibody

DCK Antibody
DF6620	Affbiotech	200ul	EUR 304
Description: DCK Antibody detects endogenous levels of total DCK.

DCK Antibody
1-CSB-PA006547GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against DCK. Recognizes DCK from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

DCK Antibody
1-CSB-PA006547LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DCK. Recognizes DCK from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

DCK Antibody
1-CSB-PA283493	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against DCK. Recognizes DCK from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

anti-DCK
YF-PA11293	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to DCK

anti-DCK
YF-PA11294	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to DCK

anti-DCK
YF-PA11295	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to DCK

anti-DCK
YF-PA11296	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to DCK

anti-DCK
YF-PA11297	Abfrontier	100 ul	EUR 403
Description: Rabbit polyclonal to DCK

anti-DCK
YF-PA11298	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to DCK

Human DCK shRNA Plasmid
20-abx951149	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

DCK Recombinant Protein (Human)
RP054264	ABM	100 ug	Ask for price

2'-Deoxycytidine hydrochloride
B4722-1000	ApexBio	1 g	EUR 203

2'-Deoxycytidine hydrochloride
B4722-5.1	ApexBio	10 mM (in 1mL H2O)	EUR 218

2'-Deoxycytidine (hydrochloride)
HY-17564	MedChemExpress	500mg	EUR 124

2'-Deoxycytidine hydrochloride
GE7787-1G	Glentham Life Sciences	1 g	EUR 66

2'-Deoxycytidine hydrochloride
GE7787-25G	Glentham Life Sciences	25 g	EUR 317

2'-Deoxycytidine hydrochloride
GE7787-5G	Glentham Life Sciences	5 g	EUR 126

2'-Deoxycytidine hydrochloride
DD0045	Bio Basic	1g	EUR 77.84
Product category: Biochemicals/Nucleic Acids/Derivatives

DCK ELISA Kit (Rat) : 96 Wells (OKEH01870)
OKEH01870	Aviva Systems Biology	96 Wells	EUR 727
Description: Description of target: kinase that phosphorylates several deoxyribonucleosides and their nucleoside analogs;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.156 ng/mL

DCK Conjugated Antibody
C32437	SAB	100ul	EUR 397

DCK cloning plasmid
CSB-CL006547HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 783 Sequence: ATGGCCACCCCGCCCAAGAGAAGCTGCCCGTCTTTCTCAGCCAGCTCTGAGGGGACCCGCATCAAGAAAATCTCCATCGAAGGGAACATCGCTGCAGGGAAGTCAACATTTGTGAATATCCTTAAACAATTGTGTGAAGATTGGGAAGTGGTTCCTGAACCTGTTGCCAGATGGTG Show more
Description: A cloning plasmid for the DCK gene.

anti- DCK antibody
FNab02265	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:200 IF: 1:50 - 1:200 Immunogen: deoxycytidine kinase Uniprot ID: P27707 Gene ID: 1633 Research Area: Metabolism
Description: Antibody raised against DCK

Anti-DCK Antibody
A01655-1	BosterBio	100ug/vial	EUR 334

DCK Rabbit pAb
A1794-100ul	Abclonal	100 ul	EUR 308

DCK Rabbit pAb
A1794-200ul	Abclonal	200 ul	EUR 459

DCK Rabbit pAb
A1794-20ul	Abclonal	20 ul	EUR 183

DCK Rabbit pAb
A1794-50ul	Abclonal	50 ul	EUR 223

DCK Blocking Peptide
33R-1569	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DCK antibody, catalog no. 70R-4406

DCK Blocking Peptide
33R-7620	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DCK antibody, catalog no. 70R-3128

DCK Blocking Peptide
DF6620-BP	Affbiotech	1mg	EUR 195

Anti-DCK antibody
PAab02265	Lifescience Market	100 ug	EUR 355

Anti-DCK Antibody
STJ500741	St John's Laboratory	100 µg	EUR 476

Anti-DCK antibody
STJ23344	St John's Laboratory	100 µl	EUR 277
Description: Deoxycytidine kinase (DCK) is required for the phosphorylation of several deoxyribonucleosides and their nucleoside analogs. Deficiency of DCK is associated with resistance to antiviral and anticancer chemotherapeutic agents. Conversely, increased deoxycytidine kinase activity is associated with increased activation of these compounds to cytotoxic nucleoside triphosphate derivatives. DCK is clinically important because of its relationship to drug resistance and sensitivity.

Anti-DCK (1E7)
YF-MA12640	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to DCK

Anti-DCK (1E6)
YF-MA12641	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to DCK

Anti-DCK (2F10)
YF-MA12642	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to DCK

Anti-DCK (3E4)
YF-MA12643	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to DCK

Anti-DCK (3D5)
YF-MA12644	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to DCK

Anti-DCK (1G6)
YF-MA12645	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to DCK

Anti-DCK (4H3)
YF-MA12646	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to DCK

Anti-DCK (1D12)
YF-MA12647	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to DCK

DCK ORF Vector (Human) (pORF)
ORF018089	ABM	1.0 ug DNA	EUR 405

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

2-Deoxycytidine 5-monophosphate
B7863-1000	ApexBio	1 g	EUR 148

N4-Acetyl-2'-deoxycytidine
GN3264-10G	Glentham Life Sciences	10 g	EUR 158

N4-Acetyl-2'-deoxycytidine
GN3264-25G	Glentham Life Sciences	25 g	EUR 269

5-Aza-2'-deoxycytidine
GP1241-100MG	Glentham Life Sciences	100 mg	EUR 126

5-Aza-2'-deoxycytidine
GP1241-25MG	Glentham Life Sciences	25 mg	EUR 70

5-Aza-2'-deoxycytidine
GP1241-5MG	Glentham Life Sciences	5 mg	EUR 50

5-Methyl-2'-deoxycytidine
GE5158-50MG	Glentham Life Sciences	50 mg	EUR 75

5-Methyl-2'-deoxycytidine
HY-W012078	MedChemExpress	10mM/1mL	EUR 113

5-Aza-2'-deoxycytidine
1754-10	Biovision		EUR 169

5-Aza-2'-deoxycytidine
1754-50	Biovision		EUR 468

5-Aza-2'-deoxycytidine
M22000	EpiGentek	50 mg	EUR 284.9
Description: Ask the seller for details

2'-Deoxycytidine-5'-monophosphoricacid
TWK01261	ChemNorm	250mg	Ask for price

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

Rat DCK shRNA Plasmid
20-abx986505	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

DCK protein (His tag)
80R-1500	Fitzgerald	100 ug	EUR 457
Description: Purified recombinant Human DCK protein

Mouse DCK shRNA Plasmid
20-abx969959	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

DCK Antibody, HRP conjugated
1-CSB-PA006547LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DCK. Recognizes DCK from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

DCK Antibody, FITC conjugated
1-CSB-PA006547LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DCK. Recognizes DCK from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

DCK Antibody, Biotin conjugated
1-CSB-PA006547LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DCK. Recognizes DCK from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

DCK Recombinant Protein (Rat)
RP197441	ABM	100 ug	Ask for price

DCK Recombinant Protein (Mouse)
RP128054	ABM	100 ug	Ask for price

Anti-DCK Antibody BIOTIN
STJ500742	St John's Laboratory	100 µg	EUR 586

Anti-DCK Antibody FITC
STJ500743	St John's Laboratory	100 µg	EUR 586

DCK sgRNA CRISPR Lentivector set (Human)
K0565501	ABM	3 x 1.0 ug	EUR 339

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Global DNA Methylation ELISA Kit (5?-methyl-2?-deoxycytidine Quantitation)
STA-380	Cell Biolabs	96 assays	EUR 624
Description: The Global DNA Methylation ELISA Kit is a competitive ELISA for the quantitative measurement of 5-methylcytosine (5MedCyd). The unknown 5MedCyd samples or 5MedCyd standards are first added to a 5MedCyd DNA conjugate coated EIA plate. After a brief incubation, an anti-5MedCyd monoclonal antibody is added, followed by an HRP conjugated secondary antibody. The 5MedCyd content in unknown samples is determined by comparison with a predetermined 5MedCyd standard curve.

Global DNA Methylation ELISA Kit (5?-methyl-2?-deoxycytidine Quantitation)
STA-380-5	Cell Biolabs	5 x 96 assays	EUR 2503
Description: The Global DNA Methylation ELISA Kit is a competitive ELISA for the quantitative measurement of 5-methylcytosine (5MedCyd). The unknown 5MedCyd samples or 5MedCyd standards are first added to a 5MedCyd DNA conjugate coated EIA plate. After a brief incubation, an anti-5MedCyd monoclonal antibody is added, followed by an HRP conjugated secondary antibody. The 5MedCyd content in unknown samples is determined by comparison with a predetermined 5MedCyd standard curve.

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV200PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV205PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV220PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV225PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS750A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS770A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS790A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]
CAS9LIG-KIT	SBI	1 Kit	EUR 153
Category: Cas9

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

Dck ORF Vector (Rat) (pORF)
ORF065815	ABM	1.0 ug DNA	EUR 506

Anti-DCK Antibody (monoclonal, 3G10)
M01655	BosterBio	100ug/vial	EUR 334

Dck ORF Vector (Mouse) (pORF)
ORF042686	ABM	1.0 ug DNA	EUR 506

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

DCK sgRNA CRISPR Lentivector (Human) (Target 1)
K0565502	ABM	1.0 ug DNA	EUR 154

DCK sgRNA CRISPR Lentivector (Human) (Target 2)
K0565503	ABM	1.0 ug DNA	EUR 154

DCK sgRNA CRISPR Lentivector (Human) (Target 3)
K0565504	ABM	1.0 ug DNA	EUR 154

DCK Protein Vector (Human) (pPB-C-His)
PV072353	ABM	500 ng	EUR 552

DCK Protein Vector (Human) (pPB-N-His)
PV072354	ABM	500 ng	EUR 552

DCK Protein Vector (Human) (pPM-C-HA)
PV072355	ABM	500 ng	EUR 552

DCK Protein Vector (Human) (pPM-C-His)
PV072356	ABM	500 ng	EUR 552

Recombinant Human DCK Protein, His, E.coli-1mg
QP11599-1mg	EnQuireBio	1mg	EUR 3655

Recombinant Human DCK Protein, His, E.coli-20ug
QP11599-20ug	EnQuireBio	20ug	EUR 201

Recombinant Human DCK Protein, His, E.coli-5ug
QP11599-5ug	EnQuireBio	5ug	EUR 155

2'-Fluoro-2'-deoxycytidine-5'-Triphosphate
B7961-.01	ApexBio	10 µl (100 mM)	EUR 142

2'-Fluoro-2'-deoxycytidine-5'-Triphosphate
B7961-.05	ApexBio	50 µl (100 mM)	EUR 308

2'-Fluoro-2'-deoxycytidine-5'-Triphosphate
B7961-.1	ApexBio	100 µl (100 mM)	EUR 518

2'-Fluoro-2'-deoxycytidine-5'-Triphosphate
B7961-.5	ApexBio	5x100 µl (100 mM)	EUR 2059

2'-Fluoro-2'-deoxycytidine-5'-Triphosphate
B7961-1	ApexBio	10 x 100 µl (100 mM)	EUR 2504

2'-Amino-2'-deoxycytidine-5'-Triphosphate
B7979-.01	ApexBio	10 µl (100 mM)	EUR 209

2'-Amino-2'-deoxycytidine-5'-Triphosphate
B7979-.05	ApexBio	50 µl (100 mM)	EUR 799

2'-Amino-2'-deoxycytidine-5'-Triphosphate
B7979-.1	ApexBio	100 µl (100 mM)	EUR 1334

2'-Azido-2'-deoxycytidine-5'-Triphosphate
B7981-.01	ApexBio	10 µl (100 mM)	EUR 209

2'-Azido-2'-deoxycytidine-5'-Triphosphate
B7981-.05	ApexBio	50 µl (100 mM)	EUR 799

2'-Azido-2'-deoxycytidine-5'-Triphosphate
B7981-.1	ApexBio	100 µl (100 mM)	EUR 1334

2'-Deoxycytidine 5'-monophosphate free acid
DB0361	Bio Basic	250mg	EUR 84.8
Product category: Biochemicals/Nucleic Acids/Derivatives

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE620A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/micca.org/public_html/wp-content/plugins/gentaur-linking/vendor_prefixed/pwpf/src/View/View.php on line 66

Human DCK(Deoxycytidine Kinase) ELISA Kit