Human EPYC(Epiphycan) ELISA Kit

Human EPYC(Epiphycan) ELISA Kit

Human Epiphycan (EPYC) ELISA Kit

RDR-EPYC-Hu-96Tests 96 Tests
EUR 756

Human Epiphycan (EPYC) ELISA Kit

RD-EPYC-Hu-48Tests 48 Tests
EUR 521

Human Epiphycan (EPYC) ELISA Kit

RD-EPYC-Hu-96Tests 96 Tests
EUR 723

Human Epiphycan (EPYC)ELISA Kit

201-12-2676 96 tests
EUR 440
  • This Epiphycan ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Epiphycan (EPYC) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Epiphycan (EPYC) ELISA Kit

abx252401-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human EPYC(Epiphycan) ELISA Kit

EH3009 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q99645
  • Alias: EPYC/PG-Lb/SLRR3B/Dermatan sulfate proteoglycan 3dermatan sulphate proteoglycan 3/DSPG3proteoglycan-lb/epiphycan/PGLB/Pg-Lb/PG-Lb/Proteoglycan-Lb/SLRR3Bepiphycan proteoglycan/Small chondroitin
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Epiphycan, EPYC ELISA KIT

ELI-47275h 96 Tests
EUR 824

Human Epiphycan(EPYC)ELISA Kit

QY-E03113 96T
EUR 361

Human Epiphycan (EPYC) ELISA Kit

SEJ227Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Epiphycan (EPYC) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Epiphycan (EPYC) in Tissue homogenates and other biological fluids.

Human Epiphycan (EPYC) ELISA Kit

SEJ227Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Epiphycan (EPYC) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Epiphycan (EPYC) in Tissue homogenates and other biological fluids.

Human Epiphycan (EPYC) ELISA Kit

SEJ227Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Epiphycan (EPYC) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Epiphycan (EPYC) in Tissue homogenates and other biological fluids.

Human Epiphycan (EPYC) ELISA Kit

SEJ227Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Epiphycan (EPYC) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Epiphycan (EPYC) in Tissue homogenates and other biological fluids.

Human Epiphycan (EPYC) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Epiphycan elisa. Alternative names of the recognized antigen: DSPG3
  • Pg-Lb
  • SLRR3B
  • Dermatan Sulphate Proteoglycan 3
  • Dermatan Sulfate Proteoglycan 3
  • Proteoglycan-Lb
  • Small chondroitin/dermatan sulfate proteoglycan
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Epiphycan (EPYC) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Bovine Epiphycan, EPYC ELISA KIT

ELI-26891b 96 Tests
EUR 928

Chicken Epiphycan (EPYC) ELISA Kit

abx354637-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Monkey Epiphycan (EPYC) ELISA Kit

abx354912-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Pig Epiphycan (EPYC) ELISA Kit

abx355061-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Epiphycan (EPYC) ELISA Kit

abx355328-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Mouse Epiphycan, Epyc ELISA KIT

ELI-32781m 96 Tests
EUR 865

Chicken Epiphycan, EPYC ELISA KIT

ELI-47715c 96 Tests
EUR 928

Epiphycan (EPYC) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Epiphycan (EPYC) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Epiphycan (EPYC) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Recombinant Epiphycan (EPYC)

  • EUR 440.48
  • EUR 221.00
  • EUR 1376.80
  • EUR 525.60
  • EUR 951.20
  • EUR 358.00
  • EUR 3292.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q99645
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 28.1kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Epiphycan expressed in: E.coli

Recombinant Epiphycan (EPYC)

  • EUR 485.28
  • EUR 233.00
  • EUR 1544.80
  • EUR 581.60
  • EUR 1063.20
  • EUR 388.00
  • EUR 3712.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P70186
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 26.3kDa
  • Isoelectric Point: 6.9
Description: Recombinant Mouse Epiphycan expressed in: E.coli

ELISA kit for Human EPYC (Epiphycan)

E-EL-H0370 1 plate of 96 wells
EUR 534
  • Gentaur's EPYC ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human EPYC. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human EPYC (Epiphycan) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human EPYC (Epiphycan)

ELK3102 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Epiphycan (EPYC). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Epiphycan (EPYC).
  • Show more
Description: A sandwich ELISA kit for detection of Epiphycan from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Epiphycan (EPYC) CLIA Kit

abx195548-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Epiphycan (EPYC) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Epiphycan (EPYC) Protein

  • EUR 620.00
  • EUR 272.00
  • EUR 1859.00
  • EUR 732.00
  • EUR 453.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Guinea pig Epiphycan (EPYC) ELISA Kit

abx354871-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Mouse Epiphycan (EPYC) Protein

  • EUR 676.00
  • EUR 286.00
  • EUR 2082.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

CLIA kit for Human EPYC (Epiphycan)

E-CL-H0301 1 plate of 96 wells
EUR 584
  • Gentaur's EPYC CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human EPYC . Standards or samples are added to the micro CLIA plate wells and combined with the
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Human EPYC (Epiphycan) in samples from Serum, Plasma, Cell supernatant

Epiphycan (EPYC) Polyclonal Antibody (Human)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EPYC (His110~Pro317)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Epiphycan (EPYC)

Epiphycan (EPYC) Polyclonal Antibody (Human), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EPYC (His110~Pro317)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Epiphycan (EPYC). This antibody is labeled with APC.

Epiphycan (EPYC) Polyclonal Antibody (Human), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EPYC (His110~Pro317)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Epiphycan (EPYC). This antibody is labeled with Biotin.

Epiphycan (EPYC) Polyclonal Antibody (Human), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EPYC (His110~Pro317)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Epiphycan (EPYC). This antibody is labeled with Cy3.

Epiphycan (EPYC) Polyclonal Antibody (Human), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EPYC (His110~Pro317)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Epiphycan (EPYC). This antibody is labeled with FITC.

Epiphycan (EPYC) Polyclonal Antibody (Human), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EPYC (His110~Pro317)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Epiphycan (EPYC). This antibody is labeled with HRP.

Epiphycan (EPYC) Polyclonal Antibody (Human), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EPYC (His110~Pro317)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Epiphycan (EPYC). This antibody is labeled with PE.

Epiphycan (EPYC) Polyclonal Antibody (Mouse, Rat)

  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EPYC (Cys130~Ile322)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Epiphycan (EPYC)

Epiphycan (EPYC) Polyclonal Antibody (Human), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EPYC (His110~Pro317)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Epiphycan (EPYC). This antibody is labeled with APC-Cy7.

Epiphycan (EPYC) Polyclonal Antibody (Mouse, Rat), APC

  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EPYC (Cys130~Ile322)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Epiphycan (EPYC). This antibody is labeled with APC.

Epiphycan (EPYC) Polyclonal Antibody (Mouse, Rat), Biotinylated

  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EPYC (Cys130~Ile322)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Epiphycan (EPYC). This antibody is labeled with Biotin.

Epiphycan (EPYC) Polyclonal Antibody (Mouse, Rat), Cy3

  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EPYC (Cys130~Ile322)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Epiphycan (EPYC). This antibody is labeled with Cy3.

Epiphycan (EPYC) Polyclonal Antibody (Mouse, Rat), FITC

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EPYC (Cys130~Ile322)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Epiphycan (EPYC). This antibody is labeled with FITC.

Epiphycan (EPYC) Polyclonal Antibody (Mouse, Rat), HRP

  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EPYC (Cys130~Ile322)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Epiphycan (EPYC). This antibody is labeled with HRP.

Epiphycan (EPYC) Polyclonal Antibody (Mouse, Rat), PE

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EPYC (Cys130~Ile322)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Epiphycan (EPYC). This antibody is labeled with PE.

Epiphycan (EPYC) Polyclonal Antibody (Mouse, Rat), APC-Cy7

  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EPYC (Cys130~Ile322)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Epiphycan (EPYC). This antibody is labeled with APC-Cy7.


EF006788 96 Tests
EUR 689


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

Human EPYC shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

EPYC Recombinant Protein (Human)

RP010831 100 ug Ask for price

EPYC Polyclonal Antibody

ABP58493-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human EPYC protein at amino acid sequence of 140-220
  • Applications tips:
Description: A polyclonal antibody for detection of EPYC from Human, Mouse. This EPYC antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EPYC protein at amino acid sequence of 140-220

EPYC Polyclonal Antibody

ABP58493-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human EPYC protein at amino acid sequence of 140-220
  • Applications tips:
Description: A polyclonal antibody for detection of EPYC from Human, Mouse. This EPYC antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EPYC protein at amino acid sequence of 140-220

EPYC Polyclonal Antibody

ABP58493-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human EPYC protein at amino acid sequence of 140-220
  • Applications tips:
Description: A polyclonal antibody for detection of EPYC from Human, Mouse. This EPYC antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EPYC protein at amino acid sequence of 140-220

EPYC cloning plasmid

CSB-CL007757HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 969
  • Sequence: atgaagacattagcaggacttgttctgggacttgtcatctttgatgctgctgtgactgccccaactctagagtccatcaactatgactcagaaacctatgatgccaccttagaagacctggataatttgtacaactatgaaaacatacctgttggtaaagttgagattgaaatagc
  • Show more
Description: A cloning plasmid for the EPYC gene.

EPYC Polyclonal Antibody

ES11217-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against EPYC from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

EPYC Polyclonal Antibody

ES11217-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against EPYC from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-EPYC antibody

STJ192375 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to EPYC

Anti-EPYC (2G6)

YF-MA20319 100 ug
EUR 363
Description: Mouse monoclonal to EPYC

EPYC ORF Vector (Human) (pORF)

ORF003611 1.0 ug DNA
EUR 95

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Mouse EPYC shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

EPYC Recombinant Protein (Rat)

RP199832 100 ug Ask for price

EPYC Recombinant Protein (Mouse)

RP132080 100 ug Ask for price

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

EPYC sgRNA CRISPR Lentivector set (Human)

K0689901 3 x 1.0 ug
EUR 339

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

Human EPYC(Epiphycan) ELISA Kit