Human JAG1(Jagged 1 Protein) ELISA Kit

Notice: Trying to access array offset on value of type bool in /home/fwsoeulh/domains/ on line 182

Notice: Trying to access array offset on value of type bool in /home/fwsoeulh/domains/ on line 196

Notice: Trying to access array offset on value of type bool in /home/fwsoeulh/domains/ on line 217

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/ on line 103

Human JAG1(Jagged 1 Protein) ELISA Kit

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/ on line 64

Human Jagged 1 Protein (JAG1) ELISA Kit

RD-JAG1-Hu-96Tests 96 Tests
EUR 692.00

Mouse Jagged 1 Protein (JAG1) ELISA Kit

DLR-JAG1-Mu-48T 48T
EUR 508.00

Notice: Undefined index: index in /home/fwsoeulh/domains/ on line 142
  • Should the Mouse Jagged 1 Protein (JAG1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Jagged 1 Protein (JAG1) in samples from tissue homogenates or other biological fluids.

Mouse Jagged 1 Protein (JAG1) ELISA Kit

DLR-JAG1-Mu-96T 96T
EUR 661.00

Notice: Undefined index: index in /home/fwsoeulh/domains/ on line 142
  • Should the Mouse Jagged 1 Protein (JAG1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Jagged 1 Protein (JAG1) in samples from tissue homogenates or other biological fluids.

Mouse Jagged 1 Protein (JAG1) ELISA Kit

RDR-JAG1-Mu-48Tests 48 Tests
EUR 534.00

Mouse Jagged 1 Protein (JAG1) ELISA Kit

RDR-JAG1-Mu-96Tests 96 Tests
EUR 742.00

Mouse Jagged 1 Protein (JAG1) ELISA Kit

RD-JAG1-Mu-48Tests 48 Tests
EUR 511.00

Mouse Jagged 1 Protein (JAG1) ELISA Kit

RD-JAG1-Mu-96Tests 96 Tests
EUR 709.00

Notice: Undefined index: image in /home/fwsoeulh/domains/ on line 65

Human Jagged 1 Protein (JAG1) ELISA Kit

  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 0
  • 1
  • 2

Notice: Undefined index: url in /home/fwsoeulh/domains/ on line 142

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/ on line 142
  • Shipped within 5-7 working days.

Human Jagged 1 Protein, JAG1 ELISA Kit

ELA-E2164h 96 Tests
EUR 824.00

Human JAG1/ Protein jagged-1 ELISA Kit

E1358Hu 1 Kit
EUR 571.00

Human Protein jagged- 1, JAG1 ELISA KIT

ELI-06946h 96 Tests
EUR 824.00

Human Protein jagged-1(JAG1) ELISA kit

CSB-EL011927HU-24T 1 plate of 24 wells
EUR 165.00

Notice: Undefined index: index in /home/fwsoeulh/domains/ on line 142
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Protein jagged-1 (JAG1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Notice: Undefined index: image in /home/fwsoeulh/domains/ on line 65

Human Protein jagged-1(JAG1) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 0
  • 1
  • 2

Notice: Undefined index: url in /home/fwsoeulh/domains/ on line 142

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/ on line 142
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Protein jagged-1(JAG1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Protein jagged-1 (JAG1) ELISA Kit

abx570714-96tests 96 tests
EUR 668.00

Notice: Undefined index: index in /home/fwsoeulh/domains/ on line 142
  • Shipped within 5-12 working days.

Human Jagged 1 Protein(JAG1)ELISA Kit

QY-E04851 96T
EUR 394.00

Human Jagged 1 Protein ELISA Kit (JAG1)

RK01715 96 Tests
EUR 521.00

Human Jagged 1 Protein (JAG1) ELISA Kit

SEB807Hu-10x96wellstestplate 10x96-wells test plate
EUR 4502.43

Notice: Undefined index: index in /home/fwsoeulh/domains/ on line 142
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Jagged 1 Protein (JAG1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Jagged 1 Protein (JAG1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Jagged 1 Protein (JAG1) ELISA Kit

SEB807Hu-1x48wellstestplate 1x48-wells test plate
EUR 458.44

Notice: Undefined index: index in /home/fwsoeulh/domains/ on line 142
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Jagged 1 Protein (JAG1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Jagged 1 Protein (JAG1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Jagged 1 Protein (JAG1) ELISA Kit

SEB807Hu-1x96wellstestplate 1x96-wells test plate
EUR 612.05

Notice: Undefined index: index in /home/fwsoeulh/domains/ on line 142
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Jagged 1 Protein (JAG1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Jagged 1 Protein (JAG1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Jagged 1 Protein (JAG1) ELISA Kit

SEB807Hu-5x96wellstestplate 5x96-wells test plate
EUR 2454.23

Notice: Undefined index: index in /home/fwsoeulh/domains/ on line 142
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Jagged 1 Protein (JAG1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Jagged 1 Protein (JAG1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Notice: Undefined index: image in /home/fwsoeulh/domains/ on line 65

Human Jagged 1 Protein (JAG1) ELISA Kit

  • EUR 4553.00
  • EUR 2405.00
  • EUR 613.00
  • 0
  • 1
  • 2

Notice: Undefined index: url in /home/fwsoeulh/domains/ on line 142

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/ on line 142
  • Known also as Jagged 1 Protein elisa. Alternative names of the recognized antigen: CD339
  • AGS
  • AHD
  • AWS
  • HJ1
  • JAGL1
  • Alagille Syndrome
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Jagged 1 Protein (JAG1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Notice: Undefined index: image in /home/fwsoeulh/domains/ on line 65

Human Jagged 1 Protein (JAG1) Protein

  • EUR 606.00
  • EUR 258.00
  • EUR 1817.00
  • EUR 718.00
  • EUR 439.00
  • 0
  • 1
  • 2
  • 3
  • 4

Notice: Undefined index: url in /home/fwsoeulh/domains/ on line 142

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/ on line 142
  • Shipped within 5-15 working days.

Notice: Undefined index: image in /home/fwsoeulh/domains/ on line 65

Human Jagged 1 Protein (JAG1) Protein

  • EUR 606.00
  • EUR 258.00
  • EUR 1817.00
  • EUR 718.00
  • EUR 439.00
  • 0
  • 1
  • 2
  • 3
  • 4

Notice: Undefined index: url in /home/fwsoeulh/domains/ on line 142

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/ on line 142
  • Shipped within 5-15 working days.

Notice: Undefined index: image in /home/fwsoeulh/domains/ on line 65

Human Jagged 1 Protein (JAG1) Protein

  • EUR 606.00
  • EUR 258.00
  • EUR 1817.00
  • EUR 718.00
  • EUR 439.00
  • 0
  • 1
  • 2
  • 3
  • 4

Notice: Undefined index: url in /home/fwsoeulh/domains/ on line 142

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/ on line 142
  • Shipped within 5-7 working days.

Rat Jag1/ Protein jagged-1 ELISA Kit

E0537Ra 1 Kit
EUR 571.00

Notice: Undefined index: image in /home/fwsoeulh/domains/ on line 65

Mouse Jagged 1 Protein (JAG1) ELISA Kit

  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 0
  • 1
  • 2

Notice: Undefined index: url in /home/fwsoeulh/domains/ on line 142

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/ on line 142
  • Shipped within 5-7 working days.

Rat Protein jagged-1 (JAG1) ELISA Kit

abx256614-96tests 96 tests
EUR 668.00

Notice: Undefined index: index in /home/fwsoeulh/domains/ on line 142
  • Shipped within 5-12 working days.

Mouse Jag1/ Protein jagged-1 ELISA Kit

E0818Mo 1 Kit
EUR 571.00

Rat Protein jagged- 1, Jag1 ELISA KIT

ELI-06944r 96 Tests
EUR 886.00

Mouse Protein jagged- 1, Jag1 ELISA KIT

ELI-06945m 96 Tests
EUR 865.00

Mouse Protein jagged-1 (JAG1) ELISA Kit

abx571056-96tests 96 tests
EUR 668.00

Notice: Undefined index: index in /home/fwsoeulh/domains/ on line 142
  • Shipped within 5-12 working days.

Rat Jag1(Protein jagged-1) ELISA Kit

ER0639 96T
EUR 567.60

Notice: Undefined index: index in /home/fwsoeulh/domains/ on line 142
  • Detection range: 78-5000 pg/ml
  • Uniprot ID: Q63722
  • Alias: Jag1/CD339/AGS/AHDMGC104644/Alagille syndrome/AWS/CD339/CD339 antigen/HJ1/hJ1/jagged 1/Jagged1/JAGL1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 46.9pg/ml

Mouse Jagged 1 Protein (JAG1) ELISA Kit

SEB807Mu-10x96wellstestplate 10x96-wells test plate
EUR 4626.78

Notice: Undefined index: index in /home/fwsoeulh/domains/ on line 142
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Jagged 1 Protein (JAG1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Jagged 1 Protein (JAG1) in Tissue homogenates and other biological fluids.

Mouse Jagged 1 Protein (JAG1) ELISA Kit

SEB807Mu-1x48wellstestplate 1x48-wells test plate
EUR 468.68

Notice: Undefined index: index in /home/fwsoeulh/domains/ on line 142
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Jagged 1 Protein (JAG1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Jagged 1 Protein (JAG1) in Tissue homogenates and other biological fluids.

Mouse Jagged 1 Protein (JAG1) ELISA Kit

SEB807Mu-1x96wellstestplate 1x96-wells test plate
EUR 626.68

Notice: Undefined index: index in /home/fwsoeulh/domains/ on line 142
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Jagged 1 Protein (JAG1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Jagged 1 Protein (JAG1) in Tissue homogenates and other biological fluids.

Mouse Jagged 1 Protein (JAG1) ELISA Kit

SEB807Mu-5x96wellstestplate 5x96-wells test plate
EUR 2520.06

Notice: Undefined index: index in /home/fwsoeulh/domains/ on line 142
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Jagged 1 Protein (JAG1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Jagged 1 Protein (JAG1) in Tissue homogenates and other biological fluids.

Notice: Undefined index: image in /home/fwsoeulh/domains/ on line 65

Mouse Jagged 1 Protein (JAG1) ELISA Kit

  • EUR 4677.00
  • EUR 2471.00
  • EUR 627.00
  • 0
  • 1
  • 2

Notice: Undefined index: url in /home/fwsoeulh/domains/ on line 142

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/ on line 142
  • Known also as Jagged 1 Protein elisa. Alternative names of the recognized antigen: CD339
  • AGS
  • AHD
  • AWS
  • HJ1
  • JAGL1
  • Alagille Syndrome
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Jagged 1 Protein (JAG1) in samples from Tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Jagged 1 Protein ELISA Kit (JAG1)

RK02964 96 Tests
EUR 521.00

ELISA kit for Human JAG1 (Jagged 1 Protein)

ELK3156 1 plate of 96 wells
EUR 432.00

Notice: Undefined index: index in /home/fwsoeulh/domains/ on line 142
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Jagged 1 Protein (JAG1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Jagged 1 P
  • Show more
Description: A sandwich ELISA kit for detection of Jagged 1 Protein from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Notice: Undefined index: image in /home/fwsoeulh/domains/ on line 65

Mouse Protein jagged-1 (Jag1)

  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5

Notice: Undefined index: url in /home/fwsoeulh/domains/ on line 142

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/ on line 142
  • MW: 53.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Protein jagged-1(Jag1),partial expressed in E.coli

Notice: Undefined index: image in /home/fwsoeulh/domains/ on line 65

Protein Jagged-1 (JAG1) Antibody

  • EUR 411.00
  • EUR 300.00
  • 0
  • 1

Notice: Undefined index: url in /home/fwsoeulh/domains/ on line 142

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/ on line 142
  • Shipped within 5-10 working days.

Notice: Undefined index: image in /home/fwsoeulh/domains/ on line 65

Protein Jagged-1 (JAG1) Antibody

  • EUR 411.00
  • EUR 300.00
  • 0
  • 1

Notice: Undefined index: url in /home/fwsoeulh/domains/ on line 142

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/ on line 142
  • Shipped within 5-10 working days.

Protein Jagged-1 (JAG1) Antibody

abx216340-100ug 100 ug
EUR 439.00

Notice: Undefined index: index in /home/fwsoeulh/domains/ on line 142
  • Shipped within 5-10 working days.

Notice: Undefined index: image in /home/fwsoeulh/domains/ on line 65

Jagged 1 Protein (JAG1) Antibody

  • EUR 1177.00
  • EUR 578.00
  • 0
  • 1

Notice: Undefined index: url in /home/fwsoeulh/domains/ on line 142

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/ on line 142
  • Please enquire.

Notice: Undefined index: image in /home/fwsoeulh/domains/ on line 65

Jagged 1 Protein (JAG1) Antibody

  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • 4

Notice: Undefined index: url in /home/fwsoeulh/domains/ on line 142

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/ on line 142
  • Shipped within 5-7 working days.

Notice: Undefined index: image in /home/fwsoeulh/domains/ on line 65

Jagged 1 Protein (JAG1) Antibody

  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • 4

Notice: Undefined index: url in /home/fwsoeulh/domains/ on line 142

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/ on line 142
  • Shipped within 5-7 working days.

Notice: Undefined index: image in /home/fwsoeulh/domains/ on line 65

Jagged 1 Protein (JAG1) Antibody

  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • 4

Notice: Undefined index: url in /home/fwsoeulh/domains/ on line 142

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/ on line 142
  • Shipped within 5-7 working days.

Protein Jagged-1 (JAG1) Antibody

abx037271-100ug 100 ug
EUR 391.00

Notice: Undefined index: index in /home/fwsoeulh/domains/ on line 142
  • Shipped within 5-10 working days.

Protein Jagged-1 (JAG1) Antibody

abx038125-100ug 100 ug
EUR 391.00

Notice: Undefined index: index in /home/fwsoeulh/domains/ on line 142
  • Shipped within 5-10 working days.

Notice: Undefined index: image in /home/fwsoeulh/domains/ on line 65

Jagged 1 Protein (JAG1) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 0
  • 1
  • 2
  • 3
  • 4

Notice: Undefined index: url in /home/fwsoeulh/domains/ on line 142

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/ on line 142
  • Shipped within 5-7 working days.

Notice: Undefined index: image in /home/fwsoeulh/domains/ on line 65

Jagged 1 Protein (JAG1) Antibody

  • EUR 815.00
  • EUR 425.00
  • 0
  • 1

Notice: Undefined index: url in /home/fwsoeulh/domains/ on line 142

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/ on line 142
  • Please enquire.

Notice: Undefined index: image in /home/fwsoeulh/domains/ on line 65

Protein Jagged-1 (JAG1) Antibody

  • EUR 314.00
  • EUR 244.00
  • 0
  • 1

Notice: Undefined index: url in /home/fwsoeulh/domains/ on line 142

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/ on line 142
  • Shipped within 5-10 working days.

Protein Jagged-1 (JAG1) Antibody

abx431368-200ul 200 ul
EUR 384.00

Notice: Undefined index: index in /home/fwsoeulh/domains/ on line 142
  • Shipped within 1-3 working days.

Notice: Undefined index: image in /home/fwsoeulh/domains/ on line 65

Protein Jagged-1 (JAG1) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4

Notice: Undefined index: url in /home/fwsoeulh/domains/ on line 142

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/ on line 142
  • Shipped within 5-10 working days.

Notice: Undefined index: image in /home/fwsoeulh/domains/ on line 65

Recombinant Jagged 1 Protein (JAG1)

  • EUR 431.52
  • EUR 218.00
  • EUR 1343.20
  • EUR 514.40
  • EUR 928.80
  • EUR 352.00
  • EUR 3208.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • 6

Notice: Undefined index: url in /home/fwsoeulh/domains/ on line 142

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/ on line 142
  • Uniprot ID: P78504
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 25.8kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Jagged 1 Protein expressed in: E.coli

Notice: Undefined index: image in /home/fwsoeulh/domains/ on line 65

Recombinant Jagged 1 Protein (JAG1)

  • EUR 431.52
  • EUR 218.00
  • EUR 1343.20
  • EUR 514.40
  • EUR 928.80
  • EUR 352.00
  • EUR 3208.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • 6

Notice: Undefined index: url in /home/fwsoeulh/domains/ on line 142

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/ on line 142
  • Uniprot ID: P78504
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 41.0kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Jagged 1 Protein expressed in: E.coli

Notice: Undefined index: image in /home/fwsoeulh/domains/ on line 65

Recombinant Jagged 1 Protein (JAG1)

  • EUR 431.52
  • EUR 218.00
  • EUR 1343.20
  • EUR 514.40
  • EUR 928.80
  • EUR 352.00
  • EUR 3208.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • 6

Notice: Undefined index: url in /home/fwsoeulh/domains/ on line 142

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/ on line 142
  • Uniprot ID: P78504
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 24.3kDa
  • Isoelectric Point: 5.7
Description: Recombinant Human Jagged 1 Protein expressed in: E.coli

Notice: Undefined index: image in /home/fwsoeulh/domains/ on line 65

Recombinant Jagged 1 Protein (JAG1)

  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • 6

Notice: Undefined index: url in /home/fwsoeulh/domains/ on line 142

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/ on line 142
  • Uniprot ID: Q9QXX0
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 32.0kDa
  • Isoelectric Point: 6.7
Description: Recombinant Mouse Jagged 1 Protein expressed in: E.coli

Notice: Undefined index: image in /home/fwsoeulh/domains/ on line 65

Human Jagged 1 Protein (JAG1) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 0
  • 1
  • 2

Notice: Undefined index: url in /home/fwsoeulh/domains/ on line 142

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/ on line 142
  • Please enquire.

Recombinant Human Jagged-1/JAG1 Protein

RP00877 10 μg
EUR 221.00

Notice: Undefined index: image in /home/fwsoeulh/domains/ on line 65

Mouse Jagged 1 Protein (JAG1) Protein

  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 0
  • 1
  • 2
  • 3
  • 4

Notice: Undefined index: url in /home/fwsoeulh/domains/ on line 142

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/ on line 142
  • Shipped within 5-7 working days.

ELISA kit for Mouse JAG1 (Jagged 1 Protein)

ELK3597 1 plate of 96 wells
EUR 432.00

Notice: Undefined index: index in /home/fwsoeulh/domains/ on line 142
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Jagged 1 Protein (JAG1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Jagged 1 P
  • Show more
Description: A sandwich ELISA kit for detection of Jagged 1 Protein from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Jag1 ELISA Kit| Rat Protein jagged-1 ELISA Kit

EF017455 96 Tests
EUR 689.00

Notice: Undefined index: image in /home/fwsoeulh/domains/ on line 65

Mouse Jagged 1 Protein (JAG1) CLIA Kit

  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 0
  • 1
  • 2

Notice: Undefined index: url in /home/fwsoeulh/domains/ on line 142

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/ on line 142
  • Please enquire.

Notice: Undefined index: image in /home/fwsoeulh/domains/ on line 65

Jagged 1 Protein (JAG1) Antibody (Biotin)

  • EUR 439.00
  • EUR 244.00
  • EUR 1261.00
  • EUR 606.00
  • EUR 328.00
  • 0
  • 1
  • 2
  • 3
  • 4

Notice: Undefined index: url in /home/fwsoeulh/domains/ on line 142

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/ on line 142
  • Shipped within 5-15 working days.

Notice: Undefined index: image in /home/fwsoeulh/domains/ on line 65

Protein Jagged-1 (JAG1) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4

Notice: Undefined index: url in /home/fwsoeulh/domains/ on line 142

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/ on line 142
  • Shipped within 5-10 working days.

Notice: Undefined index: image in /home/fwsoeulh/domains/ on line 65

Protein Jagged-1 (JAG1) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4

Notice: Undefined index: url in /home/fwsoeulh/domains/ on line 142

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/ on line 142
  • Shipped within 5-10 working days.

Notice: Undefined index: image in /home/fwsoeulh/domains/ on line 65

Protein Jagged-1 (JAG1) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4

Notice: Undefined index: url in /home/fwsoeulh/domains/ on line 142

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/ on line 142
  • Shipped within 5-10 working days.

Notice: Undefined index: image in /home/fwsoeulh/domains/ on line 65

Jagged 1 Protein (JAG1) Antibody (Biotin)

  • EUR 439.00
  • EUR 244.00
  • EUR 1247.00
  • EUR 606.00
  • EUR 328.00
  • 0
  • 1
  • 2
  • 3
  • 4

Notice: Undefined index: url in /home/fwsoeulh/domains/ on line 142

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/ on line 142
  • Shipped within 5-7 working days.

Jagged 1 (JAG1) polyclonal antibody

ABP-PAB-10531 100 ug Ask for price

Notice: Undefined index: index in /home/fwsoeulh/domains/ on line 142
    • Product line: Cell Surface Molecules / GPCRs
    • Brand:

Notice: Undefined index: image in /home/fwsoeulh/domains/ on line 65

Jagged 1 Protein (JAG1) Polyclonal Antibody (Mouse)

  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 0
  • 1
  • 2
  • 3
  • 4

Notice: Undefined index: url in /home/fwsoeulh/domains/ on line 142

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/ on line 142
  • Sequence of the immunogen: JAG1 (Ser826~Cys1084)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Jagged 1 Protein (JAG1)

Notice: Undefined index: image in /home/fwsoeulh/domains/ on line 65

Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Rat)

  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 0
  • 1
  • 2
  • 3
  • 4

Notice: Undefined index: url in /home/fwsoeulh/domains/ on line 142

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/ on line 142
  • Sequence of the immunogen: JAG1 (Gly33~Asp250)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Jagged 1 Protein (JAG1)

Notice: Undefined index: image in /home/fwsoeulh/domains/ on line 65

Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Rat)

  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 0
  • 1
  • 2
  • 3
  • 4

Notice: Undefined index: url in /home/fwsoeulh/domains/ on line 142

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/ on line 142
  • Sequence of the immunogen: JAG1 (Gly470~Thr834)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Jagged 1 Protein (JAG1)

Notice: Undefined index: image in /home/fwsoeulh/domains/ on line 65

Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Rat), APC

  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 0
  • 1
  • 2
  • 3
  • 4

Notice: Undefined index: url in /home/fwsoeulh/domains/ on line 142

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/ on line 142
  • Sequence of the immunogen: JAG1 (Gly33~Asp250)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Jagged 1 Protein (JAG1). This antibody is labeled with APC.

Notice: Undefined index: image in /home/fwsoeulh/domains/ on line 65

Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Rat), Biotinylated

  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 0
  • 1
  • 2
  • 3
  • 4

Notice: Undefined index: url in /home/fwsoeulh/domains/ on line 142

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/ on line 142
  • Sequence of the immunogen: JAG1 (Gly33~Asp250)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Jagged 1 Protein (JAG1). This antibody is labeled with Biotin.

Notice: Undefined index: image in /home/fwsoeulh/domains/ on line 65

Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Rat), Cy3

  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 0
  • 1
  • 2
  • 3
  • 4

Notice: Undefined index: url in /home/fwsoeulh/domains/ on line 142

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/ on line 142
  • Sequence of the immunogen: JAG1 (Gly33~Asp250)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Jagged 1 Protein (JAG1). This antibody is labeled with Cy3.

Notice: Undefined index: image in /home/fwsoeulh/domains/ on line 65

Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Rat), FITC

  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 0
  • 1
  • 2
  • 3
  • 4

Notice: Undefined index: url in /home/fwsoeulh/domains/ on line 142

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/ on line 142
  • Sequence of the immunogen: JAG1 (Gly33~Asp250)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Jagged 1 Protein (JAG1). This antibody is labeled with FITC.

Notice: Undefined index: image in /home/fwsoeulh/domains/ on line 65

Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Rat), HRP

  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 0
  • 1
  • 2
  • 3
  • 4

Notice: Undefined index: url in /home/fwsoeulh/domains/ on line 142

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/ on line 142
  • Sequence of the immunogen: JAG1 (Gly33~Asp250)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Jagged 1 Protein (JAG1). This antibody is labeled with HRP.

Notice: Undefined index: image in /home/fwsoeulh/domains/ on line 65

Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Rat), PE

  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 0
  • 1
  • 2
  • 3
  • 4

Notice: Undefined index: url in /home/fwsoeulh/domains/ on line 142

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/ on line 142
  • Sequence of the immunogen: JAG1 (Gly33~Asp250)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Jagged 1 Protein (JAG1). This antibody is labeled with PE.

Notice: Undefined index: image in /home/fwsoeulh/domains/ on line 65

Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Rat), APC

  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 0
  • 1
  • 2
  • 3
  • 4

Notice: Undefined index: url in /home/fwsoeulh/domains/ on line 142

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/ on line 142
  • Sequence of the immunogen: JAG1 (Gly470~Thr834)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Jagged 1 Protein (JAG1). This antibody is labeled with APC.

Notice: Undefined index: image in /home/fwsoeulh/domains/ on line 65

Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Rat), Biotinylated

  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 0
  • 1
  • 2
  • 3
  • 4

Notice: Undefined index: url in /home/fwsoeulh/domains/ on line 142

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/ on line 142
  • Sequence of the immunogen: JAG1 (Gly470~Thr834)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Jagged 1 Protein (JAG1). This antibody is labeled with Biotin.

Notice: Undefined index: image in /home/fwsoeulh/domains/ on line 65

Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Rat), Cy3

  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 0
  • 1
  • 2
  • 3
  • 4

Notice: Undefined index: url in /home/fwsoeulh/domains/ on line 142

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/ on line 142
  • Sequence of the immunogen: JAG1 (Gly470~Thr834)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Jagged 1 Protein (JAG1). This antibody is labeled with Cy3.

Notice: Undefined index: image in /home/fwsoeulh/domains/ on line 65

Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Rat), FITC

  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 0
  • 1
  • 2
  • 3
  • 4

Notice: Undefined index: url in /home/fwsoeulh/domains/ on line 142

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/ on line 142
  • Sequence of the immunogen: JAG1 (Gly470~Thr834)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Jagged 1 Protein (JAG1). This antibody is labeled with FITC.

Notice: Undefined index: image in /home/fwsoeulh/domains/ on line 65

Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Rat), HRP

  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 0
  • 1
  • 2
  • 3
  • 4

Notice: Undefined index: url in /home/fwsoeulh/domains/ on line 142

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/ on line 142
  • Sequence of the immunogen: JAG1 (Gly470~Thr834)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Jagged 1 Protein (JAG1). This antibody is labeled with HRP.

Notice: Undefined index: image in /home/fwsoeulh/domains/ on line 65

Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Rat), PE

  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 0
  • 1
  • 2
  • 3
  • 4

Notice: Undefined index: url in /home/fwsoeulh/domains/ on line 142

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/ on line 142
  • Sequence of the immunogen: JAG1 (Gly470~Thr834)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Jagged 1 Protein (JAG1). This antibody is labeled with PE.

Notice: Undefined index: image in /home/fwsoeulh/domains/ on line 65

Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Mouse, Pig)

  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 0
  • 1
  • 2
  • 3
  • 4

Notice: Undefined index: url in /home/fwsoeulh/domains/ on line 142

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/ on line 142
  • Sequence of the immunogen: JAG1 (Val836~Ser1047)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Jagged 1 Protein (JAG1)

Notice: Undefined index: image in /home/fwsoeulh/domains/ on line 65

Jagged 1 Protein (JAG1) Polyclonal Antibody (Mouse), APC

  • EUR 340.00
  • EUR 3203.00
  • EUR 894.00
  • EUR 432.00
  • EUR 217.00
  • 0
  • 1
  • 2
  • 3
  • 4

Notice: Undefined index: url in /home/fwsoeulh/domains/ on line 142

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/ on line 142
  • Sequence of the immunogen: JAG1 (Ser826~Cys1084)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Jagged 1 Protein (JAG1). This antibody is labeled with APC.

Notice: Undefined index: image in /home/fwsoeulh/domains/ on line 65

Jagged 1 Protein (JAG1) Polyclonal Antibody (Mouse), Biotinylated

  • EUR 307.00
  • EUR 2407.00
  • EUR 714.00
  • EUR 375.00
  • EUR 217.00
  • 0
  • 1
  • 2
  • 3
  • 4

Notice: Undefined index: url in /home/fwsoeulh/domains/ on line 142

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/ on line 142
  • Sequence of the immunogen: JAG1 (Ser826~Cys1084)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Jagged 1 Protein (JAG1). This antibody is labeled with Biotin.

Notice: Undefined index: image in /home/fwsoeulh/domains/ on line 65

Jagged 1 Protein (JAG1) Polyclonal Antibody (Mouse), Cy3

  • EUR 411.00
  • EUR 4229.00
  • EUR 1151.00
  • EUR 535.00
  • EUR 248.00
  • 0
  • 1
  • 2
  • 3
  • 4

Notice: Undefined index: url in /home/fwsoeulh/domains/ on line 142

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/ on line 142
  • Sequence of the immunogen: JAG1 (Ser826~Cys1084)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Jagged 1 Protein (JAG1). This antibody is labeled with Cy3.

Notice: Undefined index: image in /home/fwsoeulh/domains/ on line 65

Jagged 1 Protein (JAG1) Polyclonal Antibody (Mouse), FITC

  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 0
  • 1
  • 2
  • 3
  • 4

Notice: Undefined index: url in /home/fwsoeulh/domains/ on line 142

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/ on line 142
  • Sequence of the immunogen: JAG1 (Ser826~Cys1084)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Jagged 1 Protein (JAG1). This antibody is labeled with FITC.

Notice: Undefined index: image in /home/fwsoeulh/domains/ on line 65

Jagged 1 Protein (JAG1) Polyclonal Antibody (Mouse), HRP

  • EUR 311.00
  • EUR 2792.00
  • EUR 791.00
  • EUR 391.00
  • EUR 205.00
  • 0
  • 1
  • 2
  • 3
  • 4

Notice: Undefined index: url in /home/fwsoeulh/domains/ on line 142

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/ on line 142
  • Sequence of the immunogen: JAG1 (Ser826~Cys1084)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Jagged 1 Protein (JAG1). This antibody is labeled with HRP.

Notice: Undefined index: image in /home/fwsoeulh/domains/ on line 65

Jagged 1 Protein (JAG1) Polyclonal Antibody (Mouse), PE

  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 0
  • 1
  • 2
  • 3
  • 4

Notice: Undefined index: url in /home/fwsoeulh/domains/ on line 142

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/ on line 142
  • Sequence of the immunogen: JAG1 (Ser826~Cys1084)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Jagged 1 Protein (JAG1). This antibody is labeled with PE.

Recombinant Human Jagged-1/JAG1/CD339 (C-Fc)

CB95-10ug 10ug
EUR 202.00
Description: Lyophilized from a 0.2 μm filtered solution of PBS,pH7.4.

Recombinant Human Jagged-1/JAG1/CD339 (C-Fc)

CB95-1mg 1mg
EUR 2283.00
Description: Lyophilized from a 0.2 μm filtered solution of PBS,pH7.4.

Recombinant Human Jagged-1/JAG1/CD339 (C-Fc)

CB95-500ug 500ug
EUR 1613.00
Description: Lyophilized from a 0.2 μm filtered solution of PBS,pH7.4.

Recombinant Human Jagged-1/JAG1/CD339 (C-Fc)

CB95-50ug 50ug
EUR 496.00
Description: Lyophilized from a 0.2 μm filtered solution of PBS,pH7.4.

Polyclonal JAG1 / Jagged 1 Antibody (aa110-125)

AMM06032G 0.05mg
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human JAG1 / Jagged 1 (aa110-125). This antibody is tested and proven to work in the following applications:

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202.00

Notice: Undefined index: image in /home/fwsoeulh/domains/ on line 65

Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Rat), APC-Cy7

  • EUR 547.00
  • EUR 6106.00
  • EUR 1624.00
  • EUR 727.00
  • EUR 310.00
  • 0
  • 1
  • 2
  • 3
  • 4

Notice: Undefined index: url in /home/fwsoeulh/domains/ on line 142

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/ on line 142
  • Sequence of the immunogen: JAG1 (Gly33~Asp250)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Jagged 1 Protein (JAG1). This antibody is labeled with APC-Cy7.

Notice: Undefined index: image in /home/fwsoeulh/domains/ on line 65

Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Rat), APC-Cy7

  • EUR 547.00
  • EUR 6106.00
  • EUR 1624.00
  • EUR 727.00
  • EUR 310.00
  • 0
  • 1
  • 2
  • 3
  • 4

Notice: Undefined index: url in /home/fwsoeulh/domains/ on line 142

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/ on line 142
  • Sequence of the immunogen: JAG1 (Gly470~Thr834)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Jagged 1 Protein (JAG1). This antibody is labeled with APC-Cy7.

Notice: Undefined index: image in /home/fwsoeulh/domains/ on line 65

Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Mouse, Pig), APC

  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 0
  • 1
  • 2
  • 3
  • 4

Notice: Undefined index: url in /home/fwsoeulh/domains/ on line 142

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/ on line 142
  • Sequence of the immunogen: JAG1 (Val836~Ser1047)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Jagged 1 Protein (JAG1). This antibody is labeled with APC.

Notice: Undefined index: image in /home/fwsoeulh/domains/ on line 65

Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Mouse, Pig), Biotinylated

  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 0
  • 1
  • 2
  • 3
  • 4

Notice: Undefined index: url in /home/fwsoeulh/domains/ on line 142

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/ on line 142
  • Sequence of the immunogen: JAG1 (Val836~Ser1047)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Jagged 1 Protein (JAG1). This antibody is labeled with Biotin.

Notice: Undefined index: image in /home/fwsoeulh/domains/ on line 65

Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Mouse, Pig), Cy3

  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 0
  • 1
  • 2
  • 3
  • 4

Notice: Undefined index: url in /home/fwsoeulh/domains/ on line 142

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/ on line 142
  • Sequence of the immunogen: JAG1 (Val836~Ser1047)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Jagged 1 Protein (JAG1). This antibody is labeled with Cy3.

Notice: Undefined index: image in /home/fwsoeulh/domains/ on line 65

Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Mouse, Pig), FITC

  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 0
  • 1
  • 2
  • 3
  • 4

Notice: Undefined index: url in /home/fwsoeulh/domains/ on line 142

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/ on line 142
  • Sequence of the immunogen: JAG1 (Val836~Ser1047)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Jagged 1 Protein (JAG1). This antibody is labeled with FITC.

Notice: Undefined index: image in /home/fwsoeulh/domains/ on line 65

Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Mouse, Pig), HRP

  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 0
  • 1
  • 2
  • 3
  • 4

Notice: Undefined index: url in /home/fwsoeulh/domains/ on line 142

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/ on line 142
  • Sequence of the immunogen: JAG1 (Val836~Ser1047)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Jagged 1 Protein (JAG1). This antibody is labeled with HRP.

Notice: Undefined index: image in /home/fwsoeulh/domains/ on line 65

Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Mouse, Pig), PE

  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 0
  • 1
  • 2
  • 3
  • 4

Notice: Undefined index: url in /home/fwsoeulh/domains/ on line 142

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/ on line 142
  • Sequence of the immunogen: JAG1 (Val836~Ser1047)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Jagged 1 Protein (JAG1). This antibody is labeled with PE.

Notice: Undefined index: image in /home/fwsoeulh/domains/ on line 65

Jagged 1 Protein (JAG1) Polyclonal Antibody (Mouse), APC-Cy7

  • EUR 560.00
  • EUR 6286.00
  • EUR 1669.00
  • EUR 745.00
  • EUR 315.00
  • 0
  • 1
  • 2
  • 3
  • 4

Notice: Undefined index: url in /home/fwsoeulh/domains/ on line 142

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/ on line 142
  • Sequence of the immunogen: JAG1 (Ser826~Cys1084)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Jagged 1 Protein (JAG1). This antibody is labeled with APC-Cy7.

Notice: Undefined index: image in /home/fwsoeulh/domains/ on line 65

Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Mouse, Pig), APC-Cy7

  • EUR 547.00
  • EUR 6106.00
  • EUR 1624.00
  • EUR 727.00
  • EUR 310.00
  • 0
  • 1
  • 2
  • 3
  • 4

Notice: Undefined index: url in /home/fwsoeulh/domains/ on line 142

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/ on line 142
  • Sequence of the immunogen: JAG1 (Val836~Ser1047)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Jagged 1 Protein (JAG1). This antibody is labeled with APC-Cy7.

Human Jagged 1 Protein ELISA kit

E01J0006-192T 192 tests
EUR 1270.00

Notice: Undefined index: index in /home/fwsoeulh/domains/ on line 142
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Jagged 1 Protein ELISA kit

E01J0006-48 1 plate of 48 wells
EUR 520.00

Notice: Undefined index: index in /home/fwsoeulh/domains/ on line 142
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Jagged 1 Protein ELISA kit

E01J0006-96 1 plate of 96 wells
EUR 685.00

Notice: Undefined index: index in /home/fwsoeulh/domains/ on line 142
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human Protein jagged-1

EK4347 96 tests
EUR 553.00
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Protein jagged-1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Rat Jagged 1 Protein ELISA kit

E02J0006-192T 192 tests
EUR 1270.00

Notice: Undefined index: index in /home/fwsoeulh/domains/ on line 142
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Jagged 1 Protein ELISA kit

E02J0006-48 1 plate of 48 wells
EUR 520.00

Notice: Undefined index: index in /home/fwsoeulh/domains/ on line 142
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Jagged 1 Protein ELISA kit

E02J0006-96 1 plate of 96 wells
EUR 685.00

Notice: Undefined index: index in /home/fwsoeulh/domains/ on line 142
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Jagged 1 Protein ELISA kit

E04J0006-192T 192 tests
EUR 1270.00

Notice: Undefined index: index in /home/fwsoeulh/domains/ on line 142
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Jagged 1 Protein ELISA kit

E04J0006-48 1 plate of 48 wells
EUR 520.00

Notice: Undefined index: index in /home/fwsoeulh/domains/ on line 142
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Jagged 1 Protein ELISA kit

E04J0006-96 1 plate of 96 wells
EUR 685.00

Notice: Undefined index: index in /home/fwsoeulh/domains/ on line 142
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Jagged 1 Protein ELISA kit

E03J0006-192T 192 tests
EUR 1270.00

Notice: Undefined index: index in /home/fwsoeulh/domains/ on line 142
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Jagged 1 Protein ELISA kit

E03J0006-48 1 plate of 48 wells
EUR 520.00

Notice: Undefined index: index in /home/fwsoeulh/domains/ on line 142
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Jagged 1 Protein ELISA kit

E03J0006-96 1 plate of 96 wells
EUR 685.00

Notice: Undefined index: index in /home/fwsoeulh/domains/ on line 142
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Jagged 1 Protein ELISA kit

E09J0006-192T 192 tests
EUR 1270.00

Notice: Undefined index: index in /home/fwsoeulh/domains/ on line 142
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Jagged 1 Protein ELISA kit

E09J0006-48 1 plate of 48 wells
EUR 520.00

Notice: Undefined index: index in /home/fwsoeulh/domains/ on line 142
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Jagged 1 Protein ELISA kit

E09J0006-96 1 plate of 96 wells
EUR 685.00

Notice: Undefined index: index in /home/fwsoeulh/domains/ on line 142
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Jagged 1 Protein ELISA kit

E06J0006-192T 192 tests
EUR 1270.00

Notice: Undefined index: index in /home/fwsoeulh/domains/ on line 142
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Jagged 1 Protein ELISA kit

E06J0006-48 1 plate of 48 wells
EUR 520.00

Notice: Undefined index: index in /home/fwsoeulh/domains/ on line 142
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Jagged 1 Protein ELISA kit

E06J0006-96 1 plate of 96 wells
EUR 685.00

Notice: Undefined index: index in /home/fwsoeulh/domains/ on line 142
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Jagged 1 Protein ELISA kit

E08J0006-192T 192 tests
EUR 1270.00

Notice: Undefined index: index in /home/fwsoeulh/domains/ on line 142
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Jagged 1 Protein ELISA kit

E08J0006-48 1 plate of 48 wells
EUR 520.00

Notice: Undefined index: index in /home/fwsoeulh/domains/ on line 142
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Jagged 1 Protein ELISA kit

E08J0006-96 1 plate of 96 wells
EUR 685.00

Notice: Undefined index: index in /home/fwsoeulh/domains/ on line 142
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Jagged 1 Protein ELISA kit

E07J0006-192T 192 tests
EUR 1270.00

Notice: Undefined index: index in /home/fwsoeulh/domains/ on line 142
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Jagged 1 Protein ELISA kit

E07J0006-48 1 plate of 48 wells
EUR 520.00

Notice: Undefined index: index in /home/fwsoeulh/domains/ on line 142
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Jagged 1 Protein ELISA kit

E07J0006-96 1 plate of 96 wells
EUR 685.00

Notice: Undefined index: index in /home/fwsoeulh/domains/ on line 142
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Jagged 1 Protein ELISA kit

E05J0006-192T 192 tests
EUR 1270.00

Notice: Undefined index: index in /home/fwsoeulh/domains/ on line 142
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Jagged 1 Protein ELISA kit

E05J0006-48 1 plate of 48 wells
EUR 520.00

Notice: Undefined index: index in /home/fwsoeulh/domains/ on line 142
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Jagged 1 Protein ELISA kit

E05J0006-96 1 plate of 96 wells
EUR 685.00

Notice: Undefined index: index in /home/fwsoeulh/domains/ on line 142
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Rat Protein jagged-1

EK4348 96 tests
EUR 553.00
Description: Enzyme-linked immunosorbent assay kit for quantification of Rat Protein jagged-1 in samples from serum, plasma, tissue homogenates and other biological fluids.

JAG1 ELISA Kit (Human) (OKCD02666)

OKCD02666 96 Wells
EUR 792.00
Description: Description of target: Ligand for multiple Notch receptors and involved in the mediation of Notch signaling. May be involved in cell-fate decisions during hematopoiesis. Seems to be involved in early and late stages of mammalian cardiovascular development. Inhibits myoblast differentiation. Enhances fibroblast growth factor-induced angiogenesis (in vitro).;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.056 ng/mL

Human Jagged 2 Protein (JAG2) ELISA Kit

DLR-JAG2-Hu-48T 48T
EUR 554.00

Notice: Undefined index: index in /home/fwsoeulh/domains/ on line 142
  • Should the Human Jagged 2 Protein (JAG2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Jagged 2 Protein (JAG2) in samples from serum, plasma or other biological fluids.

Human Jagged 2 Protein (JAG2) ELISA Kit

DLR-JAG2-Hu-96T 96T
EUR 725.00

Notice: Undefined index: index in /home/fwsoeulh/domains/ on line 142
  • Should the Human Jagged 2 Protein (JAG2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Jagged 2 Protein (JAG2) in samples from serum, plasma or other biological fluids.

Notice: Undefined index: image in /home/fwsoeulh/domains/ on line 65

Human Jagged 2 Protein (JAG2) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 0
  • 1
  • 2

Notice: Undefined index: url in /home/fwsoeulh/domains/ on line 142

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/ on line 142
  • Shipped within 5-7 working days.

Human Protein jagged- 2, JAG2 ELISA KIT

ELI-19919h 96 Tests
EUR 824.00

Human Protein Jagged-2 (JAG2) ELISA Kit

abx573196-96tests 96 tests
EUR 668.00

Notice: Undefined index: index in /home/fwsoeulh/domains/ on line 142
  • Shipped within 1-3 weeks.

Human Jagged 2 Protein(JAG2)ELISA Kit

QY-E04850 96T
EUR 394.00

Human Jagged 2 Protein (JAG2) ELISA Kit

RDR-JAG2-Hu-48Tests 48 Tests
EUR 589.00

Human Jagged 2 Protein (JAG2) ELISA Kit

RDR-JAG2-Hu-96Tests 96 Tests
EUR 820.00

Human Jagged 2 Protein (JAG2) ELISA Kit

RD-JAG2-Hu-48Tests 48 Tests
EUR 563.00

Human Jagged 2 Protein (JAG2) ELISA Kit

RD-JAG2-Hu-96Tests 96 Tests
EUR 783.00

Human Jagged 2 Protein (JAG2) ELISA Kit

SEL636Hu-10x96wellstestplate 10x96-wells test plate
EUR 5189.65

Notice: Undefined index: index in /home/fwsoeulh/domains/ on line 142
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Jagged 2 Protein (JAG2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Jagged 2 Protein (JAG2) in serum, plasma, tissue homogenates and other biological fluids.

Human Jagged 2 Protein (JAG2) ELISA Kit

SEL636Hu-1x48wellstestplate 1x48-wells test plate
EUR 515.03

Notice: Undefined index: index in /home/fwsoeulh/domains/ on line 142
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Jagged 2 Protein (JAG2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Jagged 2 Protein (JAG2) in serum, plasma, tissue homogenates and other biological fluids.

Human Jagged 2 Protein (JAG2) ELISA Kit

SEL636Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.90

Notice: Undefined index: index in /home/fwsoeulh/domains/ on line 142
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Jagged 2 Protein (JAG2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Jagged 2 Protein (JAG2) in serum, plasma, tissue homogenates and other biological fluids.

Human Jagged 2 Protein (JAG2) ELISA Kit

SEL636Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05

Notice: Undefined index: index in /home/fwsoeulh/domains/ on line 142
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Jagged 2 Protein (JAG2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Jagged 2 Protein (JAG2) in serum, plasma, tissue homogenates and other biological fluids.

Notice: Undefined index: image in /home/fwsoeulh/domains/ on line 65

Human Jagged 2 Protein (JAG2) ELISA Kit

  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 0
  • 1
  • 2

Notice: Undefined index: url in /home/fwsoeulh/domains/ on line 142

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/ on line 142
  • Known also as Jagged 2 Protein elisa. Alternative names of the recognized antigen: HJ2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Jagged 2 Protein (JAG2) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Jagged 1 Antibody

EUR 316.00

Jagged 1 Antibody

EUR 146.00

Jagged 1 Antibody

48255-100ul 100ul
EUR 333.00

Jagged 1 Antibody

48255-50ul 50ul
EUR 239.00

ELISA kit for Human JAG2 (Jagged 2 Protein)

ELK7225 1 plate of 96 wells
EUR 432.00

Notice: Undefined index: index in /home/fwsoeulh/domains/ on line 142
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Jagged 2 Protein (JAG2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Jagged 2 P
  • Show more
Description: A sandwich ELISA kit for detection of Jagged 2 Protein from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

JAG1 ELISA Kit (Mouse) (OKCD02667)

OKCD02667 96 Wells
EUR 818.00
Description: Description of target: Ligand for multiple Notch receptors and involved in the mediation of Notch signaling. May be involved in cell-fate decisions during hematopoiesis. Seems to be involved in early and late stages of mammalian cardiovascular development. Inhibits myoblast differentiation. May regulate fibroblast growth factor-induced angiogenesis.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: < 6.1 pg/mL

JAG1 ELISA Kit (Rat) (OKEH03468)

OKEH03468 96 Wells
EUR 662.00
Description: Description of target: Ligand for multiple Notch receptors and involved in the mediation of Notch signaling. May be involved in cell-fate decisions during hematopoiesis. Enhances fibroblast growth factor-induced angiogenesis (in vitro). Seems to be involved in early and late stages of mammalian cardiovascular development. Inhibits myoblast differentiation. May regulate fibroblast growth factor-induced angiogenesis.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.2 pg/mL

Mouse Jag2/ Protein jagged-2 ELISA Kit

E0819Mo 1 Kit
EUR 632.00

Mouse Protein Jagged-2 (JAG2) ELISA Kit

abx555988-96tests 96 tests
EUR 668.00

Notice: Undefined index: index in /home/fwsoeulh/domains/ on line 142
  • Shipped within 1-3 weeks.

Rat Protein Jagged-2 (JAG2) ELISA Kit

abx556259-96tests 96 tests
EUR 668.00

Notice: Undefined index: index in /home/fwsoeulh/domains/ on line 142
  • Shipped within 1-3 weeks.

Mouse Protein jagged- 2, Jag2 ELISA KIT

ELI-47812m 96 Tests
EUR 865.00

Jagged 1 Blocking Peptide

EUR 153.00

Jagged 1 Conjugated Antibody

C48255 100ul
EUR 397.00

Polyclonal Jagged 1 Antibody

AMM06036G 0.1mg
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Jagged 1 . This antibody is tested and proven to work in the following applications:

Jag2 ELISA Kit| Rat Protein jagged-2 ELISA Kit

EF018869 96 Tests
EUR 689.00

Jag2 ELISA Kit| Mouse Protein jagged-2 ELISA Kit

EF015300 96 Tests
EUR 689.00

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-KIT-1 25 ul each
EUR 627.00

Notice: Undefined index: index in /home/fwsoeulh/domains/ on line 142
  • Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)

MR-KIT-1 5 reactions
EUR 1152.00

Notice: Undefined index: index in /home/fwsoeulh/domains/ on line 142
  • Category: Stem Cell Products

Recombinant human Protein jagged-2

P1266 100ug Ask for price

Notice: Undefined index: index in /home/fwsoeulh/domains/ on line 142
  • Uniprot ID: Q9Y219
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Protein jagged-2

Notice: Undefined index: image in /home/fwsoeulh/domains/ on line 65

Human Jagged 2 Protein (JAG2) CLIA Kit

  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 0
  • 1
  • 2

Notice: Undefined index: url in /home/fwsoeulh/domains/ on line 142

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/ on line 142
  • Please enquire.

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941.00

Notice: Undefined index: index in /home/fwsoeulh/domains/ on line 142
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941.00

Notice: Undefined index: index in /home/fwsoeulh/domains/ on line 142
  • Category: PinPoint Integrase Tools

JAG1 Antibody

37668-100ul 100ul
EUR 252.00

JAG1 Antibody

39567-100ul 100ul
EUR 390.00

Notice: Undefined index: image in /home/fwsoeulh/domains/ on line 65

JAG1 Antibody

  • EUR 222.00
  • EUR 195.00
  • 0
  • 1

Notice: Undefined index: url in /home/fwsoeulh/domains/ on line 142

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/ on line 142
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against JAG1. Recognizes JAG1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

Notice: Undefined index: image in /home/fwsoeulh/domains/ on line 65

JAG1 Antibody

  • EUR 317.00
  • EUR 244.00
  • 0
  • 1

Notice: Undefined index: url in /home/fwsoeulh/domains/ on line 142

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/ on line 142
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against JAG1. Recognizes JAG1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

JAG1 Antibody

DF8269 200ul
EUR 304.00
Description: JAG1 Antibody detects endogenous levels of total JAG1.

Notice: Undefined index: image in /home/fwsoeulh/domains/ on line 65

JAG1 Antibody

  • EUR 317.00
  • EUR 244.00
  • 0
  • 1

Notice: Undefined index: url in /home/fwsoeulh/domains/ on line 142

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/ on line 142
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against JAG1. Recognizes JAG1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:50-1:200

Notice: Undefined index: image in /home/fwsoeulh/domains/ on line 65

JAG1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1

Notice: Undefined index: url in /home/fwsoeulh/domains/ on line 142

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/ on line 142
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against JAG1. Recognizes JAG1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

Notice: Undefined index: image in /home/fwsoeulh/domains/ on line 65


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1

Notice: Undefined index: url in /home/fwsoeulh/domains/ on line 142

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/ on line 142
  • Shipped within 5-10 working days.

Notice: Undefined index: image in /home/fwsoeulh/domains/ on line 65


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1

Notice: Undefined index: url in /home/fwsoeulh/domains/ on line 142

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/ on line 142
  • Shipped within 5-10 working days.

Notice: Undefined index: image in /home/fwsoeulh/domains/ on line 65


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1

Notice: Undefined index: url in /home/fwsoeulh/domains/ on line 142

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/ on line 142
  • Shipped within 5-10 working days.

JAG1 Antibody

ABD8269 100 ug
EUR 438.00

Notice: Undefined index: image in /home/fwsoeulh/domains/ on line 65

Human Jagged 2 Protein (JAG2) Protein

  • EUR 634.00
  • EUR 272.00
  • EUR 1943.00
  • EUR 759.00
  • EUR 467.00
  • 0
  • 1
  • 2
  • 3
  • 4

Notice: Undefined index: url in /home/fwsoeulh/domains/ on line 142

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/ on line 142
  • Shipped within 5-7 working days.

Human Jagged 1 Protein (Gln 34-Asp 1067)

VAng-1857Lsx-1mg 1 mg
EUR 6099.00
Description: Human Jagged 1 (JAG1) protein, expressed in human 293 cells. (Uniprot ID: P78504-1)

Human Jagged 1 Protein (Gln 34-Asp 1067)

VAng-1857Lsx-50g 50 µg
EUR 848.00
Description: Human Jagged 1 (JAG1) protein, expressed in human 293 cells. (Uniprot ID: P78504-1)

Notice: Undefined index: image in /home/fwsoeulh/domains/ on line 65

Human JAG1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1

Notice: Undefined index: url in /home/fwsoeulh/domains/ on line 142

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/ on line 142
  • Shipped within 15-20 working days.

Jagged-1 (188-204) (TFA)

HY-P1846A 10mg
EUR 911.00

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110.00

Notice: Undefined index: index in /home/fwsoeulh/domains/ on line 142
  • Category: Cas9

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN300A-KIT 1 Kit
EUR 2798.00

Notice: Undefined index: index in /home/fwsoeulh/domains/ on line 142
  • Category: PinPoint Integrase Tools

JAG1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1109302 1.0 ug DNA
EUR 154.00

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805.00

Notice: Undefined index: index in /home/fwsoeulh/domains/ on line 142
  • Category: Cas9

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN400A-KIT 1 Kit
EUR 2798.00

Notice: Undefined index: index in /home/fwsoeulh/domains/ on line 142
  • Category: PinPoint Integrase Tools

Human KRAB-associated Protein 1 (KAP-1) AssayMax ELISA Kit

EK2802-1 96 Well Plate
EUR 477.00

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN410A-KIT 1 Kit
EUR 4335.00

Notice: Undefined index: index in /home/fwsoeulh/domains/ on line 142
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN412A-KIT 1 Kit
EUR 4335.00

Notice: Undefined index: index in /home/fwsoeulh/domains/ on line 142
  • Category: PinPoint Integrase Tools

JAG1 Rabbit pAb

A12733-100ul 100 ul
EUR 308.00

JAG1 Rabbit pAb

A12733-200ul 200 ul
EUR 459.00

JAG1 Rabbit pAb

A12733-20ul 20 ul
EUR 183.00

JAG1 Rabbit pAb

A12733-50ul 50 ul
EUR 223.00

JAG1 Rabbit pAb

A12754-100ul 100 ul
EUR 308.00

JAG1 Rabbit pAb

A12754-200ul 200 ul
EUR 459.00

JAG1 Rabbit pAb

A12754-20ul 20 ul
EUR 183.00

JAG1 Rabbit pAb

A12754-50ul 50 ul
EUR 223.00

JAG1 Blocking Peptide

DF8269-BP 1mg
EUR 195.00

JAG1 Conjugated Antibody

C37668 100ul
EUR 397.00

Polyclonal JAG1 Antibody

AMM06033G 0.1 mg
EUR 659.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human JAG1 . This antibody is tested and proven to work in the following applications:

JAG1 cloning plasmid

CSB-CL011927HU-10ug 10ug
EUR 1291.00

Notice: Undefined index: index in /home/fwsoeulh/domains/ on line 142
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3657
  • Sequence: atgcgttccccacggacgcgcggccggtccgggcgccccctaagcctcctgctcgccctgctctgtgccctgcgagccaaggtgtgtggggcctcgggtcagttcgagttggagatcctgtccatgcagaacgtgaacggggagctgcagaacgggaactgctgcggcggcgccc
  • Show more
Description: A cloning plasmid for the JAG1 gene.

Anti-JAG1 antibody

STJ114606 100 µl
EUR 277.00
Description: The jagged 1 protein encoded by JAG1 is the human homolog of the Drosophilia jagged protein. Human jagged 1 is the ligand for the receptor notch 1, the latter a human homolog of the Drosophilia jagged receptor notch. Mutations that alter the jagged 1 protein cause Alagille syndrome. Jagged 1 signalling through notch 1 has also been shown to play a role in hematopoiesis.

Anti-JAG1 antibody

STJ114627 100 µl
EUR 277.00
Description: The jagged 1 protein encoded by JAG1 is the human homolog of the Drosophilia jagged protein. Human jagged 1 is the ligand for the receptor notch 1, the latter a human homolog of the Drosophilia jagged receptor notch. Mutations that alter the jagged 1 protein cause Alagille syndrome. Jagged 1 signalling through notch 1 has also been shown to play a role in hematopoiesis.

Anti-JAG1 Antibody

STJ193192 200 µl
EUR 197.00

Anti-JAG1 antibody

STJ72591 100 µg
EUR 359.00


AP-STR-KIT-1 1/pk
EUR 355.00
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Human Heat Shock Factor Protein 1 (HSF 1) AssayMax ELISA kit

EH5215-1 96 Well Plate
EUR 417.00

Jagged 2 antibody

70R-5696 50 ug
EUR 467.00
Description: Rabbit polyclonal Jagged 2 antibody raised against the N terminal of JAG2

anti-Jagged 2

YF-PA24029 50 ul
EUR 334.00
Description: Mouse polyclonal to Jagged 2

Notice: Undefined index: image in /home/fwsoeulh/domains/ on line 65

Protein Jagged-2 (JAG2) Antibody

  • EUR 411.00
  • EUR 300.00
  • 0
  • 1

Notice: Undefined index: url in /home/fwsoeulh/domains/ on line 142

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/ on line 142
  • Shipped within 5-10 working days.

Notice: Undefined index: image in /home/fwsoeulh/domains/ on line 65

Jagged 2 Protein (JAG2) Antibody

  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 0
  • 1
  • 2
  • 3
  • 4

Notice: Undefined index: url in /home/fwsoeulh/domains/ on line 142

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/ on line 142
  • Shipped within 5-7 working days.

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/ on line 66

Human JAG1(Jagged 1 Protein) ELISA Kit