Human LGMN(Legumain) ELISA Kit

Human LGMN(Legumain) ELISA Kit

Human Legumain (LGMN) ELISA Kit

RDR-LGMN-Hu-96Tests 96 Tests
EUR 756

Mouse Legumain (LGMN) ELISA Kit

DLR-LGMN-Mu-48T 48T
EUR 527
  • Should the Mouse Legumain (LGMN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Legumain (LGMN) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Legumain (LGMN) ELISA Kit

DLR-LGMN-Mu-96T 96T
EUR 688
  • Should the Mouse Legumain (LGMN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Legumain (LGMN) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Legumain (LGMN) ELISA Kit

RD-LGMN-Mu-48Tests 48 Tests
EUR 533

Mouse Legumain (LGMN) ELISA Kit

RD-LGMN-Mu-96Tests 96 Tests
EUR 740

Mouse Legumain (LGMN) ELISA Kit

RDR-LGMN-Mu-48Tests 48 Tests
EUR 557

Mouse Legumain (LGMN) ELISA Kit

RDR-LGMN-Mu-96Tests 96 Tests
EUR 774

Human Legumain (LGMN) ELISA Kit

abx572419-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human LGMN/ Legumain ELISA Kit

E1457Hu 1 Kit
EUR 571

Human LGMN(Legumain) ELISA Kit

EH1372 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q99538
  • Alias: LGMN(Legumain)/AEP/LGMN1/PRSC1/Protease, cysteine 1/Asparaginyl Endopeptidase/cysteine protease 1/legumain/protease, cysteine, 1(legumain)
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Legumain, LGMN ELISA KIT

ELI-03978h 96 Tests
EUR 824

Human Legumain (LGMN) ELISA Kit

20-abx152188
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Legumain(LGMN) ELISA kit

CSB-EL012903HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitative sandwich ELISA kit for measuring Human Legumain (LGMN) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Legumain(LGMN) ELISA kit

1-CSB-EL012903HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitative sandwich ELISA kit for measuring Human Legumain(LGMN) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Legumain (LGMN) ELISA Kit

SEC564Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Legumain (LGMN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Legumain (LGMN) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Legumain (LGMN) ELISA Kit

SEC564Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Legumain (LGMN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Legumain (LGMN) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Legumain (LGMN) ELISA Kit

SEC564Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Legumain (LGMN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Legumain (LGMN) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Legumain (LGMN) ELISA Kit

SEC564Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Legumain (LGMN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Legumain (LGMN) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Legumain (LGMN) ELISA Kit

4-SEC564Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Legumain elisa. Alternative names of the recognized antigen: AEP
  • LGMN1
  • PRSC1
  • Protease, Cysteine 1
  • Asparaginyl endopeptidase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Legumain (LGMN) in samples from Serum, plasma, tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Legumain(LGMN)ELISA Kit

QY-E01245 96T
EUR 361

Human Legumain (LGMN)

1-CSB-YP012903HU
  • EUR 504.00
  • EUR 265.00
  • EUR 1832.00
  • EUR 763.00
  • EUR 1216.00
  • EUR 334.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 36.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Legumain(LGMN) expressed in Yeast

Human Legumain (LGMN)

1-CSB-EP012903HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 38.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Legumain(LGMN) expressed in E.coli

Rat Legumain (LGMN) ELISA Kit

abx515751-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Mouse Legumain (LGMN) ELISA Kit

abx571481-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Mouse Lgmn/ Legumain ELISA Kit

E0866Mo 1 Kit
EUR 571

Bovine LGMN(Legumain) ELISA Kit

EB0051 96T
EUR 567.6
  • Detection range: 78-5000 pg/ml
  • Uniprot ID: Q95M12
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Cattle;Sensitivity: 46.9pg/ml

Bovine Legumain, LGMN ELISA KIT

ELI-03977b 96 Tests
EUR 928

Mouse Legumain, Lgmn ELISA KIT

ELI-03980m 96 Tests
EUR 865

Mouse Legumain (LGMN) ELISA Kit

20-abx154315
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Cow Legumain (LGMN) ELISA Kit

abx257255-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Legumain (LGMN) ELISA Kit

SEC564Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Legumain (LGMN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Legumain (LGMN) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Legumain (LGMN) ELISA Kit

SEC564Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Legumain (LGMN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Legumain (LGMN) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Legumain (LGMN) ELISA Kit

SEC564Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Legumain (LGMN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Legumain (LGMN) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Legumain (LGMN) ELISA Kit

SEC564Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Legumain (LGMN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Legumain (LGMN) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Legumain (LGMN) ELISA Kit

4-SEC564Mu
  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Legumain elisa. Alternative names of the recognized antigen: AEP
  • LGMN1
  • PRSC1
  • Protease, Cysteine 1
  • Asparaginyl endopeptidase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Legumain (LGMN) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

ELISA kit for Human LGMN (Legumain)

ELK3223 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Legumain (LGMN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Legumain (LGMN). N
  • Show more
Description: A sandwich ELISA kit for detection of Legumain from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Legumain (LGMN)

KTE61817-48T 48T
EUR 332
  • Legumain is a cysteine protease that has a strict specificity for hydrolysis of asparaginyl bonds. This enzyme may be involved in the processing of bacterial peptides and endogenous proteins for MHC class II presentation in the lysosomal/endosomal sy
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Legumain (LGMN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Legumain (LGMN)

KTE61817-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Legumain is a cysteine protease that has a strict specificity for hydrolysis of asparaginyl bonds. This enzyme may be involved in the processing of bacterial peptides and endogenous proteins for MHC class II presentation in the lysosomal/endosomal sy
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Legumain (LGMN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Legumain (LGMN)

KTE61817-96T 96T
EUR 539
  • Legumain is a cysteine protease that has a strict specificity for hydrolysis of asparaginyl bonds. This enzyme may be involved in the processing of bacterial peptides and endogenous proteins for MHC class II presentation in the lysosomal/endosomal sy
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Legumain (LGMN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Legumain (LGMN) Antibody

20-abx126093
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Legumain (LGMN) Antibody

20-abx128416
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Legumain (LGMN) Antibody

20-abx129426
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Legumain (LGMN) Antibody

abx145639-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Legumain (LGMN) Antibody

abx031307-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Legumain (LGMN) Antibody

abx031307-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Legumain (LGMN) Antibody

20-abx173322
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Legumain (LGMN) Antibody

20-abx177320
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Legumain (LGMN) Antibody

20-abx334421
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mouse Legumain (Lgmn)

1-CSB-YP012903MO
  • EUR 586.00
  • EUR 299.00
  • EUR 2172.00
  • EUR 900.00
  • EUR 1442.00
  • EUR 382.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 36.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Legumain(Lgmn) expressed in Yeast

Mouse Legumain (Lgmn)

1-CSB-EP012903MO
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 38.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Legumain(Lgmn) expressed in E.coli

Recombinant Legumain (LGMN)

4-RPC564Hu01
  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q99538
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 51.4kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Legumain expressed in: E.coli

Recombinant Legumain (LGMN)

4-RPC564Mu01
  • EUR 485.28
  • EUR 233.00
  • EUR 1544.80
  • EUR 581.60
  • EUR 1063.20
  • EUR 388.00
  • EUR 3712.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O89017
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 51.3KDa
  • Isoelectric Point: 5.9
Description: Recombinant Mouse Legumain expressed in: E.coli

Human Legumain (LGMN) CLIA Kit

20-abx493769
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Legumain (LGMN) Protein

20-abx166733
  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

ELISA kit for Mouse LGMN (Legumain)

ELK6820 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Legumain (LGMN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Legumain (LGMN). N
  • Show more
Description: A sandwich ELISA kit for detection of Legumain from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Mouse Legumain (LGMN)

KTE71475-48T 48T
EUR 332
  • Legumain is a cysteine protease that has a strict specificity for hydrolysis of asparaginyl bonds. This enzyme may be involved in the processing of bacterial peptides and endogenous proteins for MHC class II presentation in the lysosomal/endosomal sy
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Legumain (LGMN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Legumain (LGMN)

KTE71475-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Legumain is a cysteine protease that has a strict specificity for hydrolysis of asparaginyl bonds. This enzyme may be involved in the processing of bacterial peptides and endogenous proteins for MHC class II presentation in the lysosomal/endosomal sy
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Legumain (LGMN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Legumain (LGMN)

KTE71475-96T 96T
EUR 539
  • Legumain is a cysteine protease that has a strict specificity for hydrolysis of asparaginyl bonds. This enzyme may be involved in the processing of bacterial peptides and endogenous proteins for MHC class II presentation in the lysosomal/endosomal sy
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Legumain (LGMN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

LGMN ELISA Kit| Bovine Legumain ELISA Kit

EF011005 96 Tests
EUR 689

Mouse Legumain (LGMN) CLIA Kit

20-abx493770
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse Legumain (LGMN) Protein

20-abx167282
  • EUR 676.00
  • EUR 286.00
  • EUR 2082.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Legumain (LGMN) Antibody (HRP)

20-abx336315
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Legumain (LGMN) Antibody (FITC)

20-abx336316
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Legumain (LGMN) Antibody (Biotin)

20-abx336317
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Macaca fascicularis Legumain (LGMN)

1-CSB-EP012903MOV
  • EUR 611.00
  • EUR 309.00
  • EUR 1827.00
  • EUR 939.00
  • EUR 1218.00
  • EUR 397.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 39.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Macaca fascicularis Legumain(LGMN) expressed in E.coli

Macaca fascicularis Legumain (LGMN)

1-CSB-BP012903MOVb1
  • EUR 840.00
  • EUR 332.00
  • EUR 2170.00
  • EUR 1135.00
  • EUR 1579.00
  • EUR 470.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 38.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Macaca fascicularis Legumain(LGMN) expressed in Baculovirus

LGMN Legumain Human Recombinant Protein

PROTQ99538 Regular: 10ug
EUR 317
Description: LGMN produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain (18-433 a.a.) and fused to a 6 aa His Tag at C-terminus containing a total of 422 amino acids and having a molecular mass of 48.4kDa (Molecular size on SDS-PAGE will appear at approximately 40-57kDa).;LGMN is purified by proprietary chromatographic techniques.

LGMN Legumain Mouse Recombinant Protein

PROTO89017 Regular: 10ug
EUR 317
Description: LGMN produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 426 amino acids (18-435a.a.) and having a molecular mass of 48.6kDa. (Molecular size on SDS-PAGE will appear at approximately 40-57kDa). LGMN is expressed with an 8 amino acid His tag at C-Terminus and purified by proprietary chromatographic techniques.

Legumain (LGMN) Polyclonal Antibody (Mouse)

4-PAC564Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LGMN (Val18~Tyr435)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Legumain (LGMN)

Legumain (LGMN) Polyclonal Antibody (Human, Mouse, Rat)

4-PAC564Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LGMN (Val18~Tyr433)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Legumain (LGMN)

Legumain (LGMN) Polyclonal Antibody (Mouse), APC

4-PAC564Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LGMN (Val18~Tyr435)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Legumain (LGMN). This antibody is labeled with APC.

Legumain (LGMN) Polyclonal Antibody (Mouse), Biotinylated

4-PAC564Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LGMN (Val18~Tyr435)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Legumain (LGMN). This antibody is labeled with Biotin.

Legumain (LGMN) Polyclonal Antibody (Mouse), Cy3

4-PAC564Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LGMN (Val18~Tyr435)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Legumain (LGMN). This antibody is labeled with Cy3.

Legumain (LGMN) Polyclonal Antibody (Mouse), FITC

4-PAC564Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LGMN (Val18~Tyr435)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Legumain (LGMN). This antibody is labeled with FITC.

Legumain (LGMN) Polyclonal Antibody (Mouse), HRP

4-PAC564Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LGMN (Val18~Tyr435)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Legumain (LGMN). This antibody is labeled with HRP.

Legumain (LGMN) Polyclonal Antibody (Mouse), PE

4-PAC564Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LGMN (Val18~Tyr435)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Legumain (LGMN). This antibody is labeled with PE.

Legumain (LGMN) Polyclonal Antibody (Human, Mouse, Rat), APC

4-PAC564Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LGMN (Val18~Tyr433)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Legumain (LGMN). This antibody is labeled with APC.

Legumain (LGMN) Polyclonal Antibody (Human, Mouse, Rat), Biotinylated

4-PAC564Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LGMN (Val18~Tyr433)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Legumain (LGMN). This antibody is labeled with Biotin.

Legumain (LGMN) Polyclonal Antibody (Human, Mouse, Rat), Cy3

4-PAC564Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LGMN (Val18~Tyr433)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Legumain (LGMN). This antibody is labeled with Cy3.

Legumain (LGMN) Polyclonal Antibody (Human, Mouse, Rat), FITC

4-PAC564Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LGMN (Val18~Tyr433)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Legumain (LGMN). This antibody is labeled with FITC.

Legumain (LGMN) Polyclonal Antibody (Human, Mouse, Rat), HRP

4-PAC564Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LGMN (Val18~Tyr433)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Legumain (LGMN). This antibody is labeled with HRP.

Legumain (LGMN) Polyclonal Antibody (Human, Mouse, Rat), PE

4-PAC564Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LGMN (Val18~Tyr433)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Legumain (LGMN). This antibody is labeled with PE.

Recombinant Human Legumain/ LGMN Protein, His, E.coli-100ug

QP6301-ec-100ug 100ug
EUR 408

Recombinant Human Legumain/ LGMN Protein, His, E.coli-10ug

QP6301-ec-10ug 10ug
EUR 200

Recombinant Human Legumain/ LGMN Protein, His, E.coli-1mg

QP6301-ec-1mg 1mg
EUR 1632

Recombinant Human Legumain/ LGMN Protein, His, E.coli-200ug

QP6301-ec-200ug 200ug
EUR 634

Recombinant Human Legumain/ LGMN Protein, His, E.coli-500ug

QP6301-ec-500ug 500ug
EUR 1060

Recombinant Human Legumain/ LGMN Protein, His, E.coli-50ug

QP6301-ec-50ug 50ug
EUR 263

Recombinant Human Legumain/ LGMN Protein, His, Yeast-100ug

QP6301-ye-100ug 100ug
EUR 571

Recombinant Human Legumain/ LGMN Protein, His, Yeast-10ug

QP6301-ye-10ug 10ug
EUR 272

Recombinant Human Legumain/ LGMN Protein, His, Yeast-1mg

QP6301-ye-1mg 1mg
EUR 2303

Recombinant Human Legumain/ LGMN Protein, His, Yeast-200ug

QP6301-ye-200ug 200ug
EUR 898

Recombinant Human Legumain/ LGMN Protein, His, Yeast-500ug

QP6301-ye-500ug 500ug
EUR 1505

Recombinant Human Legumain/ LGMN Protein, His, Yeast-50ug

QP6301-ye-50ug 50ug
EUR 354

Legumain (LGMN) Polyclonal Antibody (Mouse), APC-Cy7

4-PAC564Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LGMN (Val18~Tyr435)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Legumain (LGMN). This antibody is labeled with APC-Cy7.

Legumain (LGMN) Polyclonal Antibody (Human, Mouse, Rat), APC-Cy7

4-PAC564Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LGMN (Val18~Tyr433)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Legumain (LGMN). This antibody is labeled with APC-Cy7.

Recombinant Mouse Legumain/ LGMN Protein, His, E.coli-100ug

QP6302-ec-100ug 100ug
EUR 571

Recombinant Mouse Legumain/ LGMN Protein, His, E.coli-10ug

QP6302-ec-10ug 10ug
EUR 272

Recombinant Mouse Legumain/ LGMN Protein, His, E.coli-1mg

QP6302-ec-1mg 1mg
EUR 2303

Recombinant Mouse Legumain/ LGMN Protein, His, E.coli-200ug

QP6302-ec-200ug 200ug
EUR 898

Recombinant Mouse Legumain/ LGMN Protein, His, E.coli-500ug

QP6302-ec-500ug 500ug
EUR 1514

Recombinant Mouse Legumain/ LGMN Protein, His, E.coli-50ug

QP6302-ec-50ug 50ug
EUR 362

Recombinant Mouse Legumain/ LGMN Protein, His, Yeast-100ug

QP6302-ye-100ug 100ug
EUR 670

Recombinant Mouse Legumain/ LGMN Protein, His, Yeast-10ug

QP6302-ye-10ug 10ug
EUR 308

Recombinant Mouse Legumain/ LGMN Protein, His, Yeast-1mg

QP6302-ye-1mg 1mg
EUR 2747

Recombinant Mouse Legumain/ LGMN Protein, His, Yeast-200ug

QP6302-ye-200ug 200ug
EUR 1069

Recombinant Mouse Legumain/ LGMN Protein, His, Yeast-500ug

QP6302-ye-500ug 500ug
EUR 1804

Recombinant Mouse Legumain/ LGMN Protein, His, Yeast-50ug

QP6302-ye-50ug 50ug
EUR 417

Lgmn/ Rat Lgmn ELISA Kit

ELI-03979r 96 Tests
EUR 886

Human LGMN ELISA Kit

ELA-E1201h 96 Tests
EUR 824

LGMN ELISA KIT|Human

EF004361 96 Tests
EUR 689

ELISA kit for Human Legumain

EK2940 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Legumain in samples from serum, plasma, tissue homogenates and other biological fluids.

Human Legumain(total) PicoKine ELISA Kit

EK1566 96 wells
EUR 425
Description: For quantitative detection of human Legumain(total) in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Rat Legumain PicoKine ELISA Kit

EK2100 96 wells
EUR 425
Description: For quantitative detection of rat Legumain in cell culture supernates, serum and plasma (heparin, EDTA, citrate).

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

Legumain protein

80R-4330 50 ug
EUR 327
Description: Purified Recombinant Legumain protein (His tagged)

anti-Legumain

YF-PA14064 50 ug
EUR 363
Description: Mouse polyclonal to Legumain

anti-Legumain

YF-PA14065 100 ul
EUR 403
Description: Rabbit polyclonal to Legumain

anti-Legumain

YF-PA14066 100 ug
EUR 403
Description: Rabbit polyclonal to Legumain

ELISA kit for Mouse Legumain (total)

EK5744 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Legumain (total) in samples from serum, plasma, tissue homogenates and other biological fluids.

LGMN siRNA

20-abx902970
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LGMN siRNA

20-abx922498
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LGMN siRNA

20-abx922499
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LGMN protein

80R-4392 50 ug
EUR 349
Description: Purified Recombinant LGMN protein

LGMN Antibody

1-CSB-PA012903LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LGMN. Recognizes LGMN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:500-1:1000

Mouse Legumain(total) PicoKine™ ELISA Kit

EK1567 96 wells
EUR 425
Description: For quantitative detection of mouse Legumain(total) in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Human LGMN shRNA Plasmid

20-abx953802
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

LGMN Recombinant Protein (Human)

RP017755 100 ug Ask for price

Legumain/Asparaginyl Endopeptidase

E21-371 10ug
EUR 343

Anti-Legumain (M1)

YF-MA14968 100 ug
EUR 363
Description: Mouse monoclonal to Legumain

Anti-Legumain (M2)

YF-MA14969 100 ug
EUR 363
Description: Mouse monoclonal to Legumain

LGMN cloning plasmid

CSB-CL012903HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1302
  • Sequence: atggtttggaaagtagctgtattcctcagtgtggccctgggcattggtgccattcctatagatgatcctgaagatggaggcaagcactgggtggtgatcgtggcaggttcaaatggctggtataattataggcaccaggcagacgcgtgccatgcctaccagatcattcaccgca
  • Show more
Description: A cloning plasmid for the LGMN gene.

Human LGMN(Legumain) ELISA Kit