Human MMRN1(Multimerin 1) ELISA Kit

Notice: Trying to access array offset on value of type bool in /home/fwsoeulh/domains/micca.org/public_html/wp-content/plugins/gentaur-linking/app/Libs/LSPDRequest.php on line 194

Notice: Trying to access array offset on value of type bool in /home/fwsoeulh/domains/micca.org/public_html/wp-content/plugins/gentaur-linking/app/Libs/LSPDRequest.php on line 208

Notice: Trying to access array offset on value of type bool in /home/fwsoeulh/domains/micca.org/public_html/wp-content/plugins/gentaur-linking/app/Libs/LSPDRequest.php on line 229

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/micca.org/public_html/wp-content/plugins/gentaur-linking/vendor_prefixed/pwpf/src/View/View.php on line 103

Human MMRN1(Multimerin 1) ELISA Kit

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/micca.org/public_html/wp-content/plugins/gentaur-linking/vendor_prefixed/pwpf/src/View/View.php on line 64

Human Multimerin 1 (MMRN1) ELISA Kit
RD-MMRN1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Multimerin 1 (MMRN1) ELISA Kit
RD-MMRN1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Multimerin 1 (MMRN1) ELISA Kit
RDR-MMRN1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Multimerin 1 (MMRN1) ELISA Kit
RDR-MMRN1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Rat Multimerin 1 (MMRN1) ELISA Kit
DLR-MMRN1-Ra-48T	DL Develop	48T	EUR 549
Should the Rat Multimerin 1 (MMRN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Multimerin 1 (MMRN1) in samples from tissue homogenates or other biological fluids.

Rat Multimerin 1 (MMRN1) ELISA Kit
DLR-MMRN1-Ra-96T	DL Develop	96T	EUR 718
Should the Rat Multimerin 1 (MMRN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Multimerin 1 (MMRN1) in samples from tissue homogenates or other biological fluids.

Rat Multimerin 1 (MMRN1) ELISA Kit
RD-MMRN1-Ra-48Tests	Reddot Biotech	48 Tests	EUR 557

Rat Multimerin 1 (MMRN1) ELISA Kit
RD-MMRN1-Ra-96Tests	Reddot Biotech	96 Tests	EUR 775

Rat Multimerin 1 (MMRN1) ELISA Kit
RDR-MMRN1-Ra-48Tests	Reddot Biotech	48 Tests	EUR 583

Rat Multimerin 1 (MMRN1) ELISA Kit
RDR-MMRN1-Ra-96Tests	Reddot Biotech	96 Tests	EUR 811

Human MMRN1(Multimerin 1) ELISA Kit
EH3374	FN Test	96T	EUR 524.1
Detection range: 78.125-5000 pg/ml Uniprot ID: Q13201 Alias: MMRN1/Multimerin 1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.875pg/ml

Human Multimerin- 1, MMRN1 ELISA KIT
ELI-12906h	Lifescience Market	96 Tests	EUR 824

Human Multimerin 1 (MMRN1) ELISA Kit
20-abx152404	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Multimerin 1 (MMRN1) ELISA Kit
abx252769-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Multimerin-1(MMRN1) ELISA kit
CSB-EL014680HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Multimerin-1 (MMRN1) in samples from serum, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Multimerin-1(MMRN1) ELISA kit
1-CSB-EL014680HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Multimerin-1(MMRN1) in samples from serum, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Multimerin 1 (MMRN1) ELISA Kit
SEC622Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Multimerin 1 (MMRN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Multimerin 1 (MMRN1) in serum, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Multimerin 1 (MMRN1) ELISA Kit
SEC622Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Multimerin 1 (MMRN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Multimerin 1 (MMRN1) in serum, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Multimerin 1 (MMRN1) ELISA Kit
SEC622Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Multimerin 1 (MMRN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Multimerin 1 (MMRN1) in serum, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Multimerin 1 (MMRN1) ELISA Kit
SEC622Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Multimerin 1 (MMRN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Multimerin 1 (MMRN1) in serum, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Multimerin 1 (MMRN1) ELISA Kit
4-SEC622Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Multimerin 1 elisa. Alternative names of the recognized antigen: ECM EMILIN4 GPIa MMRN Glycoprotein Ia Elastin microfibril interface located protein 4 Endothelial cell multimerin Platelet glycoprotein Ia 155 kDa platelet multime Show more
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Multimerin 1 (MMRN1) in samples from Serum, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Multimerin 1(MMRN1)ELISA Kit
QY-E03738	Qayee Biotechnology	96T	EUR 361

Monkey Multimerin 1 (MMRN1) ELISA Kit
abx360319-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Pig Multimerin 1 (MMRN1) ELISA Kit
abx362079-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rabbit Multimerin 1 (MMRN1) ELISA Kit
abx363306-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Mouse Multimerin- 1, Mmrn1 ELISA KIT
ELI-42805m	Lifescience Market	96 Tests	EUR 865

Rat Multimerin 1 (MMRN1) ELISA Kit
20-abx155849	Abbexa	EUR 7237.00 EUR 3855.00 EUR 895.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Chicken Multimerin 1 (MMRN1) ELISA Kit
abx356857-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Mouse Multimerin-1 (MMRN1) ELISA Kit
abx389935-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Multimerin-1(MMRN1) ELISA kit
CSB-EL014680MO-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Multimerin-1 (MMRN1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Multimerin-1(MMRN1) ELISA kit
1-CSB-EL014680MO	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Multimerin-1(MMRN1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Rat Multimerin 1 (MMRN1) ELISA Kit
SEC622Ra-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5124.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Multimerin 1 (MMRN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Multimerin 1 (MMRN1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Multimerin 1 (MMRN1) ELISA Kit
SEC622Ra-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 509.64
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Multimerin 1 (MMRN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Multimerin 1 (MMRN1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Multimerin 1 (MMRN1) ELISA Kit
SEC622Ra-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 685.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Multimerin 1 (MMRN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Multimerin 1 (MMRN1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Multimerin 1 (MMRN1) ELISA Kit
SEC622Ra-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2783.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Multimerin 1 (MMRN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Multimerin 1 (MMRN1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Multimerin 1 (MMRN1) ELISA Kit
4-SEC622Ra	Cloud-Clone	EUR 5175.00 EUR 2734.00 EUR 686.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Multimerin 1 elisa. Alternative names of the recognized antigen: ECM EMILIN4 GPIa MMRN Glycoprotein Ia Elastin microfibril interface located protein 4 Endothelial cell multimerin Platelet glycoprotein Ia 155 kDa platelet multime Show more
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Multimerin 1 (MMRN1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat Multimerin 1(MMRN1)ELISA Kit
QY-E10231	Qayee Biotechnology	96T	EUR 361

Mouse Multimerin 1(MMRN1)ELISA Kit
QY-E21032	Qayee Biotechnology	96T	EUR 361

Multimerin 1 (MMRN1) Antibody
20-abx101098	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Multimerin 1 (MMRN1) Antibody
20-abx101099	Abbexa	EUR 453.00 EUR 133.00 EUR 1302.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Multimerin 1 (MMRN1) Antibody
20-abx005104	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Multimerin 1 (MMRN1) Antibody
20-abx029271	Abbexa	EUR 356.00 EUR 523.00	100 ul 400 ul
Shipped within 5-10 working days.

Multimerin 1 (MMRN1) Antibody
abx029271-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Multimerin 1 (MMRN1) Antibody
20-abx173637	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Multimerin 1 (MMRN1) Antibody
20-abx173638	Abbexa	EUR 913.00 EUR 467.00	1 mg 200 ug
Please enquire.

Recombinant Multimerin 1 (MMRN1)
4-RPC622Hu01	Cloud-Clone	EUR 503.20 EUR 238.00 EUR 1612.00 EUR 604.00 EUR 1108.00 EUR 400.00 EUR 3880.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q13201 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 29.6kDa Isoelectric Point: Inquire
Description: Recombinant Human Multimerin 1 expressed in: E.coli

Recombinant Multimerin 1 (MMRN1)
4-RPC622Ra01	Cloud-Clone	EUR 530.08 EUR 245.00 EUR 1712.80 EUR 637.60 EUR 1175.20 EUR 418.00 EUR 4132.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: D4A3E0 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 27.7kDa Isoelectric Point: Inquire
Description: Recombinant Rat Multimerin 1 expressed in: E.coli

ELISA kit for Human MMRN1 (Multimerin 1)
ELK3228	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Multimerin 1 (MMRN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Multimerin 1 Show more
Description: A sandwich ELISA kit for detection of Multimerin 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human MMRN1 (Multimerin 1)
E-EL-H0578	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's MMRN1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human MMRN1. Standards or samples are added to the micro ELISA plate wells and combined with Show more
Description: A sandwich ELISA kit for quantitative measurement of Human MMRN1 (Multimerin 1) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human Multimerin-1 (MMRN1)
KTE61584-48T	Abbkine	48T	EUR 332
Multimerin is a massive, soluble protein found in platelets and in the endothelium of blood vessels. It is comprised of subunits linked by interchain disulfide bonds to form large, variably sized homomultimers. Multimerin is a factor V/Va-binding pro Show more
Description: Quantitative sandwich ELISA for measuring Human Multimerin-1 (MMRN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Multimerin-1 (MMRN1)
KTE61584-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Multimerin is a massive, soluble protein found in platelets and in the endothelium of blood vessels. It is comprised of subunits linked by interchain disulfide bonds to form large, variably sized homomultimers. Multimerin is a factor V/Va-binding pro Show more
Description: Quantitative sandwich ELISA for measuring Human Multimerin-1 (MMRN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Multimerin-1 (MMRN1)
KTE61584-96T	Abbkine	96T	EUR 539
Multimerin is a massive, soluble protein found in platelets and in the endothelium of blood vessels. It is comprised of subunits linked by interchain disulfide bonds to form large, variably sized homomultimers. Multimerin is a factor V/Va-binding pro Show more
Description: Quantitative sandwich ELISA for measuring Human Multimerin-1 (MMRN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Multimerin 1 (MMRN1) CLIA Kit
20-abx493803	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Multimerin 1 (MMRN1) CLIA Kit
abx197315-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Human Multimerin 1 (MMRN1) Protein
20-abx068116	Abbexa	EUR 704.00 EUR 286.00 EUR 2165.00 EUR 829.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

ELISA kit for Rat MMRN1 (Multimerin 1)
ELK6727	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Multimerin 1 (MMRN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Multimerin 1 Show more
Description: A sandwich ELISA kit for detection of Multimerin 1 from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Mouse Multimerin-1 (MMRN1)
KTE70995-48T	Abbkine	48T	EUR 332
Multimerin is a massive, soluble protein found in platelets and in the endothelium of blood vessels. It is comprised of subunits linked by interchain disulfide bonds to form large, variably sized homomultimers. Multimerin is a factor V/Va-binding pro Show more
Description: Quantitative sandwich ELISA for measuring Mouse Multimerin-1 (MMRN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Multimerin-1 (MMRN1)
KTE70995-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Multimerin is a massive, soluble protein found in platelets and in the endothelium of blood vessels. It is comprised of subunits linked by interchain disulfide bonds to form large, variably sized homomultimers. Multimerin is a factor V/Va-binding pro Show more
Description: Quantitative sandwich ELISA for measuring Mouse Multimerin-1 (MMRN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Multimerin-1 (MMRN1)
KTE70995-96T	Abbkine	96T	EUR 539
Multimerin is a massive, soluble protein found in platelets and in the endothelium of blood vessels. It is comprised of subunits linked by interchain disulfide bonds to form large, variably sized homomultimers. Multimerin is a factor V/Va-binding pro Show more
Description: Quantitative sandwich ELISA for measuring Mouse Multimerin-1 (MMRN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Mmrn1 ELISA Kit| Mouse Multimerin-1 ELISA Kit
EF015574	Lifescience Market	96 Tests	EUR 689

Rat Multimerin 1 (MMRN1) CLIA Kit
20-abx493804	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Rat Multimerin 1 (MMRN1) Protein
20-abx068117	Abbexa	EUR 732.00 EUR 286.00 EUR 2305.00 EUR 885.00 EUR 523.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Multimerin 1 (MMRN1) Antibody (FITC)
20-abx274645	Abbexa	EUR 481.00 EUR 244.00 EUR 1414.00 EUR 662.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Multimerin 1 (MMRN1) Antibody Pair
20-abx370368	Abbexa	EUR 1748.00 EUR 1121.00	10 × 96 tests 5 × 96 tests
Shipped within 5-15 working days.

Multimerin 1 (MMRN1) Antibody Pair
20-abx370373	Abbexa	EUR 1887.00 EUR 1191.00	10 × 96 tests 5 × 96 tests
Shipped within 5-15 working days.

CLIA kit for Human MMRN1 (Multimerin 1)
E-CL-H0448	Elabscience Biotech	1 plate of 96 wells	EUR 584
Gentaur's MMRN1 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human MMRN1 . Standards or samples are added to the micro CLIA plate wells and combined with th Show more
Description: A sandwich CLIA kit for quantitative measurement of Human MMRN1 (Multimerin 1) in samples from Serum, Plasma, Cell supernatant

Multimerin 1 (MMRN1) Polyclonal Antibody (Human)
4-PAC622Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MMRN1 (Ala807~Gly1053) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Multimerin 1 (MMRN1)

Multimerin 1 (MMRN1) Polyclonal Antibody (Rat)
4-PAC622Ra01	Cloud-Clone	EUR 259.00 EUR 2708.00 EUR 670.00 EUR 328.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MMRN1 (Gln846~Ala1084) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Multimerin 1 (MMRN1)

Multimerin 1 (MMRN1) Polyclonal Antibody (Human), APC
4-PAC622Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MMRN1 (Ala807~Gly1053) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Multimerin 1 (MMRN1). This antibody is labeled with APC.

Multimerin 1 (MMRN1) Polyclonal Antibody (Human), Biotinylated
4-PAC622Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MMRN1 (Ala807~Gly1053) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Multimerin 1 (MMRN1). This antibody is labeled with Biotin.

Multimerin 1 (MMRN1) Polyclonal Antibody (Human), Cy3
4-PAC622Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MMRN1 (Ala807~Gly1053) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Multimerin 1 (MMRN1). This antibody is labeled with Cy3.

Multimerin 1 (MMRN1) Polyclonal Antibody (Human), FITC
4-PAC622Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MMRN1 (Ala807~Gly1053) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Multimerin 1 (MMRN1). This antibody is labeled with FITC.

Multimerin 1 (MMRN1) Polyclonal Antibody (Human), HRP
4-PAC622Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MMRN1 (Ala807~Gly1053) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Multimerin 1 (MMRN1). This antibody is labeled with HRP.

Multimerin 1 (MMRN1) Polyclonal Antibody (Human), PE
4-PAC622Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MMRN1 (Ala807~Gly1053) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Multimerin 1 (MMRN1). This antibody is labeled with PE.

Multimerin 1 (MMRN1) Polyclonal Antibody (Human), APC-Cy7
4-PAC622Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MMRN1 (Ala807~Gly1053) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Multimerin 1 (MMRN1). This antibody is labeled with APC-Cy7.

Multimerin 1 (MMRN1) Polyclonal Antibody (Rat), APC
4-PAC622Ra01-APC	Cloud-Clone	EUR 364.00 EUR 3545.00 EUR 980.00 EUR 467.00 EUR 227.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MMRN1 (Gln846~Ala1084) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Multimerin 1 (MMRN1). This antibody is labeled with APC.

Multimerin 1 (MMRN1) Polyclonal Antibody (Rat), Biotinylated
4-PAC622Ra01-Biotin	Cloud-Clone	EUR 325.00 EUR 2658.00 EUR 777.00 EUR 400.00 EUR 225.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MMRN1 (Gln846~Ala1084) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Multimerin 1 (MMRN1). This antibody is labeled with Biotin.

Multimerin 1 (MMRN1) Polyclonal Antibody (Rat), Cy3
4-PAC622Ra01-Cy3	Cloud-Clone	EUR 444.00 EUR 4685.00 EUR 1265.00 EUR 581.00 EUR 261.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MMRN1 (Gln846~Ala1084) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Multimerin 1 (MMRN1). This antibody is labeled with Cy3.

Multimerin 1 (MMRN1) Polyclonal Antibody (Rat), FITC
4-PAC622Ra01-FITC	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MMRN1 (Gln846~Ala1084) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Multimerin 1 (MMRN1). This antibody is labeled with FITC.

Multimerin 1 (MMRN1) Polyclonal Antibody (Rat), HRP
4-PAC622Ra01-HRP	Cloud-Clone	EUR 332.00 EUR 3089.00 EUR 866.00 EUR 421.00 EUR 213.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MMRN1 (Gln846~Ala1084) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Multimerin 1 (MMRN1). This antibody is labeled with HRP.

Multimerin 1 (MMRN1) Polyclonal Antibody (Rat), PE
4-PAC622Ra01-PE	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MMRN1 (Gln846~Ala1084) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Multimerin 1 (MMRN1). This antibody is labeled with PE.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Multimerin 1 (MMRN1) Polyclonal Antibody (Rat), APC-Cy7
4-PAC622Ra01-APC-Cy7	Cloud-Clone	EUR 608.00 EUR 6970.00 EUR 1840.00 EUR 814.00 EUR 335.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MMRN1 (Gln846~Ala1084) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Multimerin 1 (MMRN1). This antibody is labeled with APC-Cy7.

MMRN1 ELISA KIT|Human
EF006986	Lifescience Market	96 Tests	EUR 689

MMRN1 ELISA Kit (Human) (OKCD01686)
OKCD01686	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: Carrier protein for platelet (but not plasma) factor V/Va. Plays a role in the storage and stabilization of factor V in platelets. Upon release following platelet activation, may limit platelet and plasma factor Va-dependent thrombin generation. Ligand for integrin alpha-IIb/beta-3 and integrin alpha-V/beta-3 on activated platelets, and may function as an extracellular matrix or adhesive protein.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.65 ng/mL

Human Multimerin- 2, MMRN2 ELISA KIT
ELI-46323h	Lifescience Market	96 Tests	EUR 824

Human Multimerin 2 (MMRN2) ELISA Kit
20-abx152405	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Multimerin 2 (MMRN2) ELISA Kit
DLR-MMRN2-Hu-48T	DL Develop	48T	EUR 517
Should the Human Multimerin 2 (MMRN2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Multimerin 2 (MMRN2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Multimerin 2 (MMRN2) ELISA Kit
DLR-MMRN2-Hu-96T	DL Develop	96T	EUR 673
Should the Human Multimerin 2 (MMRN2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Multimerin 2 (MMRN2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Multimerin-2(MMRN2) ELISA kit
CSB-EL014681HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Multimerin-2 (MMRN2) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Multimerin-2(MMRN2) ELISA kit
1-CSB-EL014681HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Multimerin-2(MMRN2) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Multimerin 2 (MMRN2) ELISA Kit
RD-MMRN2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Multimerin 2 (MMRN2) ELISA Kit
RD-MMRN2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Multimerin 2 (MMRN2) ELISA Kit
RDR-MMRN2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Multimerin 2 (MMRN2) ELISA Kit
RDR-MMRN2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Multimerin 2(MMRN2)ELISA Kit
QY-E03737	Qayee Biotechnology	96T	EUR 361

Human Multimerin 2 (MMRN2) ELISA Kit
SEF593Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Multimerin 2 (MMRN2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Multimerin 2 (MMRN2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Multimerin 2 (MMRN2) ELISA Kit
SEF593Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Multimerin 2 (MMRN2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Multimerin 2 (MMRN2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Multimerin 2 (MMRN2) ELISA Kit
SEF593Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Multimerin 2 (MMRN2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Multimerin 2 (MMRN2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Multimerin 2 (MMRN2) ELISA Kit
SEF593Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Multimerin 2 (MMRN2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Multimerin 2 (MMRN2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Multimerin 2 (MMRN2) ELISA Kit
4-SEF593Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Multimerin 2 elisa. Alternative names of the recognized antigen: EMILIN3 EndoGlyx-1 Elastin Microfibril Interfacer 3 Elastin microfibril interface located protein 3 EndoGlyx-1 p125/p140 subunit
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Multimerin 2 (MMRN2) in samples from Serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

MMRN1 ELISA Kit (Rat) (OKCD00876)
OKCD00876	Aviva Systems Biology	96 Wells	EUR 896
Description: Description of target: ;Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.113 ng/mL

MMRN1 ELISA Kit (Mouse) (OKCA01722)
OKCA01722	Aviva Systems Biology	96 Wells	EUR 846
Description: Description of target: Carrier protein for platelet (but not plasma) factor V/Va. Plays a role in the storage and stabilization of factor V in platelets. Upon release following platelet activation, may limit platelet and plasma factor Va-dependent thrombin generation. Ligand for integrin alpha-IIb/beta-3 and integrin alpha-V/beta-3 on activated platelets, and may function as an extracellular matrix or adhesive protein.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 4.68 pg/mL

ELISA kit for Human MMRN2 (Multimerin 2)
ELK4130	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Multimerin 2 (MMRN2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Multimerin 2 Show more
Description: A sandwich ELISA kit for detection of Multimerin 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Multimerin-2 (MMRN2)
KTE61583-48T	Abbkine	48T	EUR 332
MMRN2 encodes a protein belonging to the member of elastin microfibril interface-located (EMILIN) protein family. This family member is an extracellular matrix glycoprotein that can interfere with tumor angiogenesis and growth. It serves as a transfo Show more
Description: Quantitative sandwich ELISA for measuring Human Multimerin-2 (MMRN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Multimerin-2 (MMRN2)
KTE61583-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
MMRN2 encodes a protein belonging to the member of elastin microfibril interface-located (EMILIN) protein family. This family member is an extracellular matrix glycoprotein that can interfere with tumor angiogenesis and growth. It serves as a transfo Show more
Description: Quantitative sandwich ELISA for measuring Human Multimerin-2 (MMRN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Multimerin-2 (MMRN2)
KTE61583-96T	Abbkine	96T	EUR 539
MMRN2 encodes a protein belonging to the member of elastin microfibril interface-located (EMILIN) protein family. This family member is an extracellular matrix glycoprotein that can interfere with tumor angiogenesis and growth. It serves as a transfo Show more
Description: Quantitative sandwich ELISA for measuring Human Multimerin-2 (MMRN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

MMRN1 siRNA
20-abx924332	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MMRN1 siRNA
20-abx924333	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MMRN1 antibody
39078-100ul	SAB	100ul	EUR 252

anti-MMRN1
YF-PA25811	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to MMRN1

Mouse Multimerin- 2, Mmrn2 ELISA KIT
ELI-43756m	Lifescience Market	96 Tests	EUR 865

Mouse Multimerin 2 (MMRN2) ELISA Kit
20-abx154418	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Multimerin 2 (MMRN2) ELISA Kit
DLR-MMRN2-Mu-48T	DL Develop	48T	EUR 527
Should the Mouse Multimerin 2 (MMRN2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Multimerin 2 (MMRN2) in samples from tissue homogenates or other biological fluids.

Mouse Multimerin 2 (MMRN2) ELISA Kit
DLR-MMRN2-Mu-96T	DL Develop	96T	EUR 688
Should the Mouse Multimerin 2 (MMRN2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Multimerin 2 (MMRN2) in samples from tissue homogenates or other biological fluids.

Mouse Multimerin 2 (MMRN2) ELISA Kit
RD-MMRN2-Mu-48Tests	Reddot Biotech	48 Tests	EUR 533

Mouse Multimerin 2 (MMRN2) ELISA Kit
RD-MMRN2-Mu-96Tests	Reddot Biotech	96 Tests	EUR 740

Mouse Multimerin 2 (MMRN2) ELISA Kit
RDR-MMRN2-Mu-48Tests	Reddot Biotech	48 Tests	EUR 557

Mouse Multimerin 2 (MMRN2) ELISA Kit
RDR-MMRN2-Mu-96Tests	Reddot Biotech	96 Tests	EUR 774

Mouse Multimerin 2 (MMRN2) ELISA Kit
SEF593Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4862.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Multimerin 2 (MMRN2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Multimerin 2 (MMRN2) in Tissue homogenates and other biological fluids.

Mouse Multimerin 2 (MMRN2) ELISA Kit
SEF593Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 488.08
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Multimerin 2 (MMRN2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Multimerin 2 (MMRN2) in Tissue homogenates and other biological fluids.

Mouse Multimerin 2 (MMRN2) ELISA Kit
SEF593Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 654.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Multimerin 2 (MMRN2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Multimerin 2 (MMRN2) in Tissue homogenates and other biological fluids.

Mouse Multimerin 2 (MMRN2) ELISA Kit
SEF593Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2644.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Multimerin 2 (MMRN2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Multimerin 2 (MMRN2) in Tissue homogenates and other biological fluids.

Mouse Multimerin 2 (MMRN2) ELISA Kit
4-SEF593Mu	Cloud-Clone	EUR 4913.00 EUR 2595.00 EUR 655.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Multimerin 2 elisa. Alternative names of the recognized antigen: EMILIN3 EndoGlyx-1 Elastin Microfibril Interfacer 3 Elastin microfibril interface located protein 3 EndoGlyx-1 p125/p140 subunit
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Multimerin 2 (MMRN2) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
EXOAB-KIT-1	SBI	25 ul each	EUR 627
Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1	SBI	5 reactions	EUR 1152
Category: Stem Cell Products

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

Human MMRN1 shRNA Plasmid
20-abx957868	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human Multimerin 2 (MMRN2) CLIA Kit
20-abx494958	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

MMRN1 sgRNA CRISPR Lentivector (Human) (Target 1)
K1313202	ABM	1.0 ug DNA	EUR 154

ELISA kit for Mouse MMRN2 (Multimerin 2)
ELK6348	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Multimerin 2 (MMRN2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Multimerin 2 Show more
Description: A sandwich ELISA kit for detection of Multimerin 2 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Mouse Multimerin-2 (MMRN2)
KTE70994-48T	Abbkine	48T	EUR 332
MMRN2 encodes a protein belonging to the member of elastin microfibril interface-located (EMILIN) protein family. This family member is an extracellular matrix glycoprotein that can interfere with tumor angiogenesis and growth. It serves as a transfo Show more
Description: Quantitative sandwich ELISA for measuring Mouse Multimerin-2 (MMRN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Multimerin-2 (MMRN2)
KTE70994-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
MMRN2 encodes a protein belonging to the member of elastin microfibril interface-located (EMILIN) protein family. This family member is an extracellular matrix glycoprotein that can interfere with tumor angiogenesis and growth. It serves as a transfo Show more
Description: Quantitative sandwich ELISA for measuring Mouse Multimerin-2 (MMRN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Multimerin-2 (MMRN2)
KTE70994-96T	Abbkine	96T	EUR 539
MMRN2 encodes a protein belonging to the member of elastin microfibril interface-located (EMILIN) protein family. This family member is an extracellular matrix glycoprotein that can interfere with tumor angiogenesis and growth. It serves as a transfo Show more
Description: Quantitative sandwich ELISA for measuring Mouse Multimerin-2 (MMRN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

MMRN1 Conjugated Antibody
C39078	SAB	100ul	EUR 397

MMRN1 Rabbit pAb
A6658-100ul	Abclonal	100 ul	EUR 308

MMRN1 Rabbit pAb
A6658-200ul	Abclonal	200 ul	EUR 459

MMRN1 Rabbit pAb
A6658-20ul	Abclonal	20 ul	EUR 183

MMRN1 Rabbit pAb
A6658-50ul	Abclonal	50 ul	EUR 223

MMRN1 cloning plasmid
CSB-CL622645HU-10ug	Cusabio	10ug	EUR 1301
Formulation: 10 μg plasmid + 200μl Glycerol Length: 3687 Sequence: atgaagggggcaagattatttgtccttctttctagtttatggagtgggggcattgggcttaacaacagtaagcattcttggactatacctgaggatgggaactctcagaagactatgccttctgcttcagttcctccaaataaaatacaaagtttgcaaatactgccaaccactc Show more
Description: A cloning plasmid for the MMRN1 gene.

Anti-MMRN1 antibody
STJ28741	St John's Laboratory	100 µl	EUR 277
Description: Multimerin is a massive, soluble protein found in platelets and in the endothelium of blood vessels. It is comprised of subunits linked by interchain disulfide bonds to form large, variably sized homomultimers. Multimerin is a factor V/Va-binding protein and may function as a carrier protein for platelet factor V. It may also have functions as an extracellular matrix or adhesive protein. Recently, patients with an unusual autosomal-dominant bleeding disorder (factor V Quebec) were found to have a deficiency of platelet multimerin.

Anti-MMRN1 (1G10)
YF-MA17756	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to MMRN1

Anti-MMRN1 (4B9)
YF-MA11372	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to MMRN1

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN410A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN412A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

Human Multimerin 2 (MMRN2) Protein
20-abx654417	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

MMRN1 ORF Vector (Human) (pORF)
ORF006551	ABM	1.0 ug DNA	EUR 95

AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-1	CORNING	1/pk	EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Mouse Multimerin 2 (MMRN2) CLIA Kit
20-abx494959	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Human Glutaredoxin-1 AssayMax ELISA Kit
EG2153-1	AssayPro	96 Well Plate	EUR 417

Human Complexin-1 AssayMax ELISA Kit
EC3505-1	AssayPro	96 Well Plate	EUR 417

Human Hexokinase-1 AssayMax ELISA Kit
EH3101-1	AssayPro	96 Well Plate	EUR 477

Mouse MMRN1 shRNA Plasmid
20-abx977329	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Multimerin 2 (MMRN2) Antibody
20-abx129433	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Multimerin 2 (MMRN2) Antibody
abx027169-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Multimerin 2 (MMRN2) Antibody
abx027169-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Multimerin 2 (MMRN2) Antibody
20-abx173639	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Multimerin 2 (MMRN2) Antibody
20-abx177634	Abbexa	EUR 1205.00 EUR 578.00	1 mg 200 ug
Please enquire.

Multimerin 2 (MMRN2) Antibody
20-abx177635	Abbexa	EUR 1233.00 EUR 592.00	1 mg 200 ug
Please enquire.

Recombinant Multimerin 2 (MMRN2)
4-RPF593Mu01	Cloud-Clone	EUR 476.32 EUR 230.00 EUR 1511.20 EUR 570.40 EUR 1040.80 EUR 382.00 EUR 3628.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: A6H6E2 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 22.6kDa Isoelectric Point: Inquire
Description: Recombinant Mouse Multimerin 2 expressed in: E.coli

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

Mmrn1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4093702	ABM	1.0 ug DNA	EUR 154

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE620A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

MMRN1 sgRNA CRISPR Lentivector set (Human)
K1313201	ABM	3 x 1.0 ug	EUR 339

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE622A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE624A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

Human Lipocalin-1 (LCN1) AssayMax ELISA Kit
EL3502-1	AssayPro	96 Well Plate	EUR 477

Human TGF-beta-1 AssayMax ELISA Kit
ET3102-1	AssayPro	96 Well Plate	EUR 477

Human PAI-1/tPA AssayMax ELISA Kit
EP1105-1	AssayPro	96 Well Plate	EUR 417

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

Human KRAB-associated Protein 1 (KAP-1) AssayMax ELISA Kit
EK2802-1	AssayPro	96 Well Plate	EUR 477

Human Interleukin-1 beta (IL-1 beta) AssayMax ELISA Kit
EI2200-1	AssayPro	96 Well Plate	EUR 477

Human Interleukin-1-alpha (IL-1-alpha) AssayMax ELISA Kit
EI2301-1	AssayPro	96 Well Plate	EUR 477

Human Plasminogen Activator Inhibitor-1 (PAI-1) AssayMax ELISA Kit
EP1100-1	AssayPro	96 Well Plate	EUR 417

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Human Glutathione Transferase zeta 1 AssayMax ELISA Kit
EG2350-1	AssayPro	96 Well Plate	EUR 477

Human Glutathione Peroxidase 1 (GPX1) AssayMax ELISA Kit
EG3928-1	AssayPro	96 Well Plate	EUR 477

Human Carbonic Anhydrase 1 (CA1) AssayMax ELISA Kit
EC5752-1	AssayPro	96 Well Plate	EUR 477

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/micca.org/public_html/wp-content/plugins/gentaur-linking/vendor_prefixed/pwpf/src/View/View.php on line 66

Human MMRN1(Multimerin 1) ELISA Kit