Human MMRN1(Multimerin 1) ELISA Kit

Human MMRN1(Multimerin 1) ELISA Kit

Human Multimerin 1 (MMRN1) ELISA Kit

RD-MMRN1-Hu-48Tests 48 Tests
EUR 521

Human Multimerin 1 (MMRN1) ELISA Kit

RD-MMRN1-Hu-96Tests 96 Tests
EUR 723

Human Multimerin 1 (MMRN1) ELISA Kit

RDR-MMRN1-Hu-48Tests 48 Tests
EUR 544

Human Multimerin 1 (MMRN1) ELISA Kit

RDR-MMRN1-Hu-96Tests 96 Tests
EUR 756

Rat Multimerin 1 (MMRN1) ELISA Kit

DLR-MMRN1-Ra-48T 48T
EUR 549
  • Should the Rat Multimerin 1 (MMRN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Multimerin 1 (MMRN1) in samples from tissue homogenates or other biological fluids.

Rat Multimerin 1 (MMRN1) ELISA Kit

DLR-MMRN1-Ra-96T 96T
EUR 718
  • Should the Rat Multimerin 1 (MMRN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Multimerin 1 (MMRN1) in samples from tissue homogenates or other biological fluids.

Rat Multimerin 1 (MMRN1) ELISA Kit

RD-MMRN1-Ra-48Tests 48 Tests
EUR 557

Rat Multimerin 1 (MMRN1) ELISA Kit

RD-MMRN1-Ra-96Tests 96 Tests
EUR 775

Rat Multimerin 1 (MMRN1) ELISA Kit

RDR-MMRN1-Ra-48Tests 48 Tests
EUR 583

Rat Multimerin 1 (MMRN1) ELISA Kit

RDR-MMRN1-Ra-96Tests 96 Tests
EUR 811

Human MMRN1(Multimerin 1) ELISA Kit

EH3374 96T
EUR 524.1
  • Detection range: 78.125-5000 pg/ml
  • Uniprot ID: Q13201
  • Alias: MMRN1/Multimerin 1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.875pg/ml

Human Multimerin- 1, MMRN1 ELISA KIT

ELI-12906h 96 Tests
EUR 824

Human Multimerin 1 (MMRN1) ELISA Kit

20-abx152404
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Multimerin 1 (MMRN1) ELISA Kit

abx252769-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Multimerin-1(MMRN1) ELISA kit

CSB-EL014680HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Multimerin-1 (MMRN1) in samples from serum, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Multimerin-1(MMRN1) ELISA kit

1-CSB-EL014680HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Multimerin-1(MMRN1) in samples from serum, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Multimerin 1 (MMRN1) ELISA Kit

SEC622Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Multimerin 1 (MMRN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Multimerin 1 (MMRN1) in serum, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Multimerin 1 (MMRN1) ELISA Kit

SEC622Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Multimerin 1 (MMRN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Multimerin 1 (MMRN1) in serum, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Multimerin 1 (MMRN1) ELISA Kit

SEC622Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Multimerin 1 (MMRN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Multimerin 1 (MMRN1) in serum, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Multimerin 1 (MMRN1) ELISA Kit

SEC622Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Multimerin 1 (MMRN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Multimerin 1 (MMRN1) in serum, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Multimerin 1 (MMRN1) ELISA Kit

4-SEC622Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Multimerin 1 elisa. Alternative names of the recognized antigen: ECM
  • EMILIN4
  • GPIa
  • MMRN
  • Glycoprotein Ia
  • Elastin microfibril interface located protein 4
  • Endothelial cell multimerin
  • Platelet glycoprotein Ia
  • 155 kDa platelet multime
  • Show more
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Multimerin 1 (MMRN1) in samples from Serum, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Multimerin 1(MMRN1)ELISA Kit

QY-E03738 96T
EUR 361

Monkey Multimerin 1 (MMRN1) ELISA Kit

abx360319-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Pig Multimerin 1 (MMRN1) ELISA Kit

abx362079-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Multimerin 1 (MMRN1) ELISA Kit

abx363306-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Mouse Multimerin- 1, Mmrn1 ELISA KIT

ELI-42805m 96 Tests
EUR 865

Rat Multimerin 1 (MMRN1) ELISA Kit

20-abx155849
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Chicken Multimerin 1 (MMRN1) ELISA Kit

abx356857-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Mouse Multimerin-1 (MMRN1) ELISA Kit

abx389935-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Multimerin-1(MMRN1) ELISA kit

CSB-EL014680MO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Multimerin-1 (MMRN1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Multimerin-1(MMRN1) ELISA kit

1-CSB-EL014680MO
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Multimerin-1(MMRN1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Rat Multimerin 1 (MMRN1) ELISA Kit

SEC622Ra-10x96wellstestplate 10x96-wells test plate
EUR 5124.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Multimerin 1 (MMRN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Multimerin 1 (MMRN1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Multimerin 1 (MMRN1) ELISA Kit

SEC622Ra-1x48wellstestplate 1x48-wells test plate
EUR 509.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Multimerin 1 (MMRN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Multimerin 1 (MMRN1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Multimerin 1 (MMRN1) ELISA Kit

SEC622Ra-1x96wellstestplate 1x96-wells test plate
EUR 685.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Multimerin 1 (MMRN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Multimerin 1 (MMRN1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Multimerin 1 (MMRN1) ELISA Kit

SEC622Ra-5x96wellstestplate 5x96-wells test plate
EUR 2783.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Multimerin 1 (MMRN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Multimerin 1 (MMRN1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Multimerin 1 (MMRN1) ELISA Kit

4-SEC622Ra
  • EUR 5175.00
  • EUR 2734.00
  • EUR 686.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Multimerin 1 elisa. Alternative names of the recognized antigen: ECM
  • EMILIN4
  • GPIa
  • MMRN
  • Glycoprotein Ia
  • Elastin microfibril interface located protein 4
  • Endothelial cell multimerin
  • Platelet glycoprotein Ia
  • 155 kDa platelet multime
  • Show more
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Multimerin 1 (MMRN1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat Multimerin 1(MMRN1)ELISA Kit

QY-E10231 96T
EUR 361

Mouse Multimerin 1(MMRN1)ELISA Kit

QY-E21032 96T
EUR 361

Multimerin 1 (MMRN1) Antibody

20-abx101098
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Multimerin 1 (MMRN1) Antibody

20-abx101099
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Multimerin 1 (MMRN1) Antibody

20-abx005104
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Multimerin 1 (MMRN1) Antibody

20-abx029271
  • EUR 356.00
  • EUR 523.00
  • 100 ul
  • 400 ul
  • Shipped within 5-10 working days.

Multimerin 1 (MMRN1) Antibody

abx029271-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Multimerin 1 (MMRN1) Antibody

20-abx173637
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Multimerin 1 (MMRN1) Antibody

20-abx173638
  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Recombinant Multimerin 1 (MMRN1)

4-RPC622Hu01
  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q13201
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 29.6kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Multimerin 1 expressed in: E.coli

Recombinant Multimerin 1 (MMRN1)

4-RPC622Ra01
  • EUR 530.08
  • EUR 245.00
  • EUR 1712.80
  • EUR 637.60
  • EUR 1175.20
  • EUR 418.00
  • EUR 4132.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: D4A3E0
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 27.7kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Multimerin 1 expressed in: E.coli

ELISA kit for Human MMRN1 (Multimerin 1)

ELK3228 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Multimerin 1 (MMRN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Multimerin 1
  • Show more
Description: A sandwich ELISA kit for detection of Multimerin 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human MMRN1 (Multimerin 1)

E-EL-H0578 1 plate of 96 wells
EUR 534
  • Gentaur's MMRN1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human MMRN1. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human MMRN1 (Multimerin 1) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human Multimerin-1 (MMRN1)

KTE61584-48T 48T
EUR 332
  • Multimerin is a massive, soluble protein found in platelets and in the endothelium of blood vessels. It is comprised of subunits linked by interchain disulfide bonds to form large, variably sized homomultimers. Multimerin is a factor V/Va-binding pro
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Multimerin-1 (MMRN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Multimerin-1 (MMRN1)

KTE61584-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Multimerin is a massive, soluble protein found in platelets and in the endothelium of blood vessels. It is comprised of subunits linked by interchain disulfide bonds to form large, variably sized homomultimers. Multimerin is a factor V/Va-binding pro
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Multimerin-1 (MMRN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Multimerin-1 (MMRN1)

KTE61584-96T 96T
EUR 539
  • Multimerin is a massive, soluble protein found in platelets and in the endothelium of blood vessels. It is comprised of subunits linked by interchain disulfide bonds to form large, variably sized homomultimers. Multimerin is a factor V/Va-binding pro
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Multimerin-1 (MMRN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Multimerin 1 (MMRN1) CLIA Kit

20-abx493803
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Multimerin 1 (MMRN1) CLIA Kit

abx197315-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Multimerin 1 (MMRN1) Protein

20-abx068116
  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

ELISA kit for Rat MMRN1 (Multimerin 1)

ELK6727 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Multimerin 1 (MMRN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Multimerin 1
  • Show more
Description: A sandwich ELISA kit for detection of Multimerin 1 from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Mouse Multimerin-1 (MMRN1)

KTE70995-48T 48T
EUR 332
  • Multimerin is a massive, soluble protein found in platelets and in the endothelium of blood vessels. It is comprised of subunits linked by interchain disulfide bonds to form large, variably sized homomultimers. Multimerin is a factor V/Va-binding pro
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Multimerin-1 (MMRN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Multimerin-1 (MMRN1)

KTE70995-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Multimerin is a massive, soluble protein found in platelets and in the endothelium of blood vessels. It is comprised of subunits linked by interchain disulfide bonds to form large, variably sized homomultimers. Multimerin is a factor V/Va-binding pro
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Multimerin-1 (MMRN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Multimerin-1 (MMRN1)

KTE70995-96T 96T
EUR 539
  • Multimerin is a massive, soluble protein found in platelets and in the endothelium of blood vessels. It is comprised of subunits linked by interchain disulfide bonds to form large, variably sized homomultimers. Multimerin is a factor V/Va-binding pro
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Multimerin-1 (MMRN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Mmrn1 ELISA Kit| Mouse Multimerin-1 ELISA Kit

EF015574 96 Tests
EUR 689

Rat Multimerin 1 (MMRN1) CLIA Kit

20-abx493804
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Rat Multimerin 1 (MMRN1) Protein

20-abx068117
  • EUR 732.00
  • EUR 286.00
  • EUR 2305.00
  • EUR 885.00
  • EUR 523.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Multimerin 1 (MMRN1) Antibody (FITC)

20-abx274645
  • EUR 481.00
  • EUR 244.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Multimerin 1 (MMRN1) Antibody Pair

20-abx370368
  • EUR 1748.00
  • EUR 1121.00
  • 10 × 96 tests
  • 5 × 96 tests
  • Shipped within 5-15 working days.

Multimerin 1 (MMRN1) Antibody Pair

20-abx370373
  • EUR 1887.00
  • EUR 1191.00
  • 10 × 96 tests
  • 5 × 96 tests
  • Shipped within 5-15 working days.

CLIA kit for Human MMRN1 (Multimerin 1)

E-CL-H0448 1 plate of 96 wells
EUR 584
  • Gentaur's MMRN1 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human MMRN1 . Standards or samples are added to the micro CLIA plate wells and combined with th
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Human MMRN1 (Multimerin 1) in samples from Serum, Plasma, Cell supernatant

Multimerin 1 (MMRN1) Polyclonal Antibody (Human)

4-PAC622Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MMRN1 (Ala807~Gly1053)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Multimerin 1 (MMRN1)

Multimerin 1 (MMRN1) Polyclonal Antibody (Rat)

4-PAC622Ra01
  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MMRN1 (Gln846~Ala1084)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Multimerin 1 (MMRN1)

Multimerin 1 (MMRN1) Polyclonal Antibody (Human), APC

4-PAC622Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MMRN1 (Ala807~Gly1053)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Multimerin 1 (MMRN1). This antibody is labeled with APC.

Multimerin 1 (MMRN1) Polyclonal Antibody (Human), Biotinylated

4-PAC622Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MMRN1 (Ala807~Gly1053)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Multimerin 1 (MMRN1). This antibody is labeled with Biotin.

Multimerin 1 (MMRN1) Polyclonal Antibody (Human), Cy3

4-PAC622Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MMRN1 (Ala807~Gly1053)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Multimerin 1 (MMRN1). This antibody is labeled with Cy3.

Multimerin 1 (MMRN1) Polyclonal Antibody (Human), FITC

4-PAC622Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MMRN1 (Ala807~Gly1053)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Multimerin 1 (MMRN1). This antibody is labeled with FITC.

Multimerin 1 (MMRN1) Polyclonal Antibody (Human), HRP

4-PAC622Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MMRN1 (Ala807~Gly1053)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Multimerin 1 (MMRN1). This antibody is labeled with HRP.

Multimerin 1 (MMRN1) Polyclonal Antibody (Human), PE

4-PAC622Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MMRN1 (Ala807~Gly1053)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Multimerin 1 (MMRN1). This antibody is labeled with PE.

Multimerin 1 (MMRN1) Polyclonal Antibody (Human), APC-Cy7

4-PAC622Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MMRN1 (Ala807~Gly1053)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Multimerin 1 (MMRN1). This antibody is labeled with APC-Cy7.

Multimerin 1 (MMRN1) Polyclonal Antibody (Rat), APC

4-PAC622Ra01-APC
  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MMRN1 (Gln846~Ala1084)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Multimerin 1 (MMRN1). This antibody is labeled with APC.

Multimerin 1 (MMRN1) Polyclonal Antibody (Rat), Biotinylated

4-PAC622Ra01-Biotin
  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MMRN1 (Gln846~Ala1084)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Multimerin 1 (MMRN1). This antibody is labeled with Biotin.

Multimerin 1 (MMRN1) Polyclonal Antibody (Rat), Cy3

4-PAC622Ra01-Cy3
  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MMRN1 (Gln846~Ala1084)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Multimerin 1 (MMRN1). This antibody is labeled with Cy3.

Multimerin 1 (MMRN1) Polyclonal Antibody (Rat), FITC

4-PAC622Ra01-FITC
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MMRN1 (Gln846~Ala1084)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Multimerin 1 (MMRN1). This antibody is labeled with FITC.

Multimerin 1 (MMRN1) Polyclonal Antibody (Rat), HRP

4-PAC622Ra01-HRP
  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MMRN1 (Gln846~Ala1084)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Multimerin 1 (MMRN1). This antibody is labeled with HRP.

Multimerin 1 (MMRN1) Polyclonal Antibody (Rat), PE

4-PAC622Ra01-PE
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MMRN1 (Gln846~Ala1084)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Multimerin 1 (MMRN1). This antibody is labeled with PE.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

Multimerin 1 (MMRN1) Polyclonal Antibody (Rat), APC-Cy7

4-PAC622Ra01-APC-Cy7
  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MMRN1 (Gln846~Ala1084)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Multimerin 1 (MMRN1). This antibody is labeled with APC-Cy7.

MMRN1 ELISA KIT|Human

EF006986 96 Tests
EUR 689

Human Multimerin- 2, MMRN2 ELISA KIT

ELI-46323h 96 Tests
EUR 824

Human Multimerin 2 (MMRN2) ELISA Kit

20-abx152405
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Multimerin 2 (MMRN2) ELISA Kit

DLR-MMRN2-Hu-48T 48T
EUR 517
  • Should the Human Multimerin 2 (MMRN2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Multimerin 2 (MMRN2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Multimerin 2 (MMRN2) ELISA Kit

DLR-MMRN2-Hu-96T 96T
EUR 673
  • Should the Human Multimerin 2 (MMRN2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Multimerin 2 (MMRN2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Multimerin-2(MMRN2) ELISA kit

CSB-EL014681HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Multimerin-2 (MMRN2) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Multimerin-2(MMRN2) ELISA kit

1-CSB-EL014681HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Multimerin-2(MMRN2) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Multimerin 2 (MMRN2) ELISA Kit

RD-MMRN2-Hu-48Tests 48 Tests
EUR 521

Human Multimerin 2 (MMRN2) ELISA Kit

RD-MMRN2-Hu-96Tests 96 Tests
EUR 723

Human Multimerin 2 (MMRN2) ELISA Kit

RDR-MMRN2-Hu-48Tests 48 Tests
EUR 544

Human Multimerin 2 (MMRN2) ELISA Kit

RDR-MMRN2-Hu-96Tests 96 Tests
EUR 756

Human Multimerin 2(MMRN2)ELISA Kit

QY-E03737 96T
EUR 361

Human Multimerin 2 (MMRN2) ELISA Kit

SEF593Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Multimerin 2 (MMRN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Multimerin 2 (MMRN2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Multimerin 2 (MMRN2) ELISA Kit

SEF593Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Multimerin 2 (MMRN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Multimerin 2 (MMRN2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Multimerin 2 (MMRN2) ELISA Kit

SEF593Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Multimerin 2 (MMRN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Multimerin 2 (MMRN2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Multimerin 2 (MMRN2) ELISA Kit

SEF593Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Multimerin 2 (MMRN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Multimerin 2 (MMRN2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Multimerin 2 (MMRN2) ELISA Kit

4-SEF593Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Multimerin 2 elisa. Alternative names of the recognized antigen: EMILIN3
  • EndoGlyx-1
  • Elastin Microfibril Interfacer 3
  • Elastin microfibril interface located protein 3
  • EndoGlyx-1 p125/p140 subunit
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Multimerin 2 (MMRN2) in samples from Serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

ELISA kit for Human MMRN2 (Multimerin 2)

ELK4130 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Multimerin 2 (MMRN2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Multimerin 2
  • Show more
Description: A sandwich ELISA kit for detection of Multimerin 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Multimerin-2 (MMRN2)

KTE61583-48T 48T
EUR 332
  • MMRN2 encodes a protein belonging to the member of elastin microfibril interface-located (EMILIN) protein family. This family member is an extracellular matrix glycoprotein that can interfere with tumor angiogenesis and growth. It serves as a transfo
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Multimerin-2 (MMRN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Multimerin-2 (MMRN2)

KTE61583-5platesof96wells 5 plates of 96 wells
EUR 2115
  • MMRN2 encodes a protein belonging to the member of elastin microfibril interface-located (EMILIN) protein family. This family member is an extracellular matrix glycoprotein that can interfere with tumor angiogenesis and growth. It serves as a transfo
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Multimerin-2 (MMRN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Multimerin-2 (MMRN2)

KTE61583-96T 96T
EUR 539
  • MMRN2 encodes a protein belonging to the member of elastin microfibril interface-located (EMILIN) protein family. This family member is an extracellular matrix glycoprotein that can interfere with tumor angiogenesis and growth. It serves as a transfo
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Multimerin-2 (MMRN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

MMRN1 siRNA

20-abx924332
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MMRN1 siRNA

20-abx924333
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MMRN1 antibody

39078-100ul 100ul
EUR 252

anti-MMRN1

YF-PA25811 50 ul
EUR 334
Description: Mouse polyclonal to MMRN1

Mouse Multimerin- 2, Mmrn2 ELISA KIT

ELI-43756m 96 Tests
EUR 865

Mouse Multimerin 2 (MMRN2) ELISA Kit

20-abx154418
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Multimerin 2 (MMRN2) ELISA Kit

DLR-MMRN2-Mu-48T 48T
EUR 527
  • Should the Mouse Multimerin 2 (MMRN2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Multimerin 2 (MMRN2) in samples from tissue homogenates or other biological fluids.

Mouse Multimerin 2 (MMRN2) ELISA Kit

DLR-MMRN2-Mu-96T 96T
EUR 688
  • Should the Mouse Multimerin 2 (MMRN2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Multimerin 2 (MMRN2) in samples from tissue homogenates or other biological fluids.

Mouse Multimerin 2 (MMRN2) ELISA Kit

RD-MMRN2-Mu-48Tests 48 Tests
EUR 533

Mouse Multimerin 2 (MMRN2) ELISA Kit

RD-MMRN2-Mu-96Tests 96 Tests
EUR 740

Mouse Multimerin 2 (MMRN2) ELISA Kit

RDR-MMRN2-Mu-48Tests 48 Tests
EUR 557

Mouse Multimerin 2 (MMRN2) ELISA Kit

RDR-MMRN2-Mu-96Tests 96 Tests
EUR 774

Mouse Multimerin 2 (MMRN2) ELISA Kit

SEF593Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Multimerin 2 (MMRN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Multimerin 2 (MMRN2) in Tissue homogenates and other biological fluids.

Mouse Multimerin 2 (MMRN2) ELISA Kit

SEF593Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Multimerin 2 (MMRN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Multimerin 2 (MMRN2) in Tissue homogenates and other biological fluids.

Mouse Multimerin 2 (MMRN2) ELISA Kit

SEF593Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Multimerin 2 (MMRN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Multimerin 2 (MMRN2) in Tissue homogenates and other biological fluids.

Mouse Multimerin 2 (MMRN2) ELISA Kit

SEF593Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Multimerin 2 (MMRN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Multimerin 2 (MMRN2) in Tissue homogenates and other biological fluids.

Mouse Multimerin 2 (MMRN2) ELISA Kit

4-SEF593Mu
  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Multimerin 2 elisa. Alternative names of the recognized antigen: EMILIN3
  • EndoGlyx-1
  • Elastin Microfibril Interfacer 3
  • Elastin microfibril interface located protein 3
  • EndoGlyx-1 p125/p140 subunit
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Multimerin 2 (MMRN2) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)

MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

Human MMRN1 shRNA Plasmid

20-abx957868
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human Multimerin 2 (MMRN2) CLIA Kit

20-abx494958
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

MMRN1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1313202 1.0 ug DNA
EUR 154

ELISA kit for Mouse MMRN2 (Multimerin 2)

ELK6348 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Multimerin 2 (MMRN2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Multimerin 2
  • Show more
Description: A sandwich ELISA kit for detection of Multimerin 2 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Mouse Multimerin-2 (MMRN2)

KTE70994-48T 48T
EUR 332
  • MMRN2 encodes a protein belonging to the member of elastin microfibril interface-located (EMILIN) protein family. This family member is an extracellular matrix glycoprotein that can interfere with tumor angiogenesis and growth. It serves as a transfo
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Multimerin-2 (MMRN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Multimerin-2 (MMRN2)

KTE70994-5platesof96wells 5 plates of 96 wells
EUR 2115
  • MMRN2 encodes a protein belonging to the member of elastin microfibril interface-located (EMILIN) protein family. This family member is an extracellular matrix glycoprotein that can interfere with tumor angiogenesis and growth. It serves as a transfo
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Multimerin-2 (MMRN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Multimerin-2 (MMRN2)

KTE70994-96T 96T
EUR 539
  • MMRN2 encodes a protein belonging to the member of elastin microfibril interface-located (EMILIN) protein family. This family member is an extracellular matrix glycoprotein that can interfere with tumor angiogenesis and growth. It serves as a transfo
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Multimerin-2 (MMRN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

MMRN1 Conjugated Antibody

C39078 100ul
EUR 397

MMRN1 Rabbit pAb

A6658-100ul 100 ul
EUR 308

MMRN1 Rabbit pAb

A6658-200ul 200 ul
EUR 459

MMRN1 Rabbit pAb

A6658-20ul 20 ul
EUR 183

MMRN1 Rabbit pAb

A6658-50ul 50 ul
EUR 223

MMRN1 cloning plasmid

CSB-CL622645HU-10ug 10ug
EUR 1301
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3687
  • Sequence: atgaagggggcaagattatttgtccttctttctagtttatggagtgggggcattgggcttaacaacagtaagcattcttggactatacctgaggatgggaactctcagaagactatgccttctgcttcagttcctccaaataaaatacaaagtttgcaaatactgccaaccactc
  • Show more
Description: A cloning plasmid for the MMRN1 gene.

Anti-MMRN1 antibody

STJ28741 100 µl
EUR 277
Description: Multimerin is a massive, soluble protein found in platelets and in the endothelium of blood vessels. It is comprised of subunits linked by interchain disulfide bonds to form large, variably sized homomultimers. Multimerin is a factor V/Va-binding protein and may function as a carrier protein for platelet factor V. It may also have functions as an extracellular matrix or adhesive protein. Recently, patients with an unusual autosomal-dominant bleeding disorder (factor V Quebec) were found to have a deficiency of platelet multimerin.

Anti-MMRN1 (1G10)

YF-MA17756 100 ug
EUR 363
Description: Mouse monoclonal to MMRN1

Anti-MMRN1 (4B9)

YF-MA11372 100 ug
EUR 363
Description: Mouse monoclonal to MMRN1

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

MMRN1 ORF Vector (Human) (pORF)

ORF006551 1.0 ug DNA
EUR 95

Human Multimerin 2 (MMRN2) Protein

20-abx654417
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS

AP-STR-KIT-1 1/pk
EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Mouse Multimerin 2 (MMRN2) CLIA Kit

20-abx494959
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Human Glutaredoxin-1 AssayMax ELISA Kit

EG2153-1 96 Well Plate
EUR 417

Human Complexin-1 AssayMax ELISA Kit

EC3505-1 96 Well Plate
EUR 417

Human Hexokinase-1 AssayMax ELISA Kit

EH3101-1 96 Well Plate
EUR 477

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

Mouse MMRN1 shRNA Plasmid

20-abx977329
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Multimerin 2 (MMRN2) Antibody

20-abx129433
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Multimerin 2 (MMRN2) Antibody

abx027169-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Multimerin 2 (MMRN2) Antibody

abx027169-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Multimerin 2 (MMRN2) Antibody

20-abx173639
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Multimerin 2 (MMRN2) Antibody

20-abx177634
  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Multimerin 2 (MMRN2) Antibody

20-abx177635
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Recombinant Multimerin 2 (MMRN2)

4-RPF593Mu01
  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: A6H6E2
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 22.6kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Multimerin 2 expressed in: E.coli

Mmrn1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4093702 1.0 ug DNA
EUR 154

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE620A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

MMRN1 sgRNA CRISPR Lentivector set (Human)

K1313201 3 x 1.0 ug
EUR 339

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE622A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE624A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

Human Lipocalin-1 (LCN1) AssayMax ELISA Kit

EL3502-1 96 Well Plate
EUR 477

Human TGF-beta-1 AssayMax ELISA Kit

ET3102-1 96 Well Plate
EUR 477

Human PAI-1/tPA AssayMax ELISA Kit

EP1105-1 96 Well Plate
EUR 417

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

Human KRAB-associated Protein 1 (KAP-1) AssayMax ELISA Kit

EK2802-1 96 Well Plate
EUR 477

Human Interleukin-1 beta (IL-1 beta) AssayMax ELISA Kit

EI2200-1 96 Well Plate
EUR 477

Human Interleukin-1-alpha (IL-1-alpha) AssayMax ELISA Kit

EI2301-1 96 Well Plate
EUR 477

Human Plasminogen Activator Inhibitor-1 (PAI-1) AssayMax ELISA Kit

EP1100-1 96 Well Plate
EUR 417

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV100PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV105PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV120PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV125PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Human Glutathione Transferase zeta 1 AssayMax ELISA Kit

EG2350-1 96 Well Plate
EUR 477

Human Glutathione Peroxidase 1 (GPX1) AssayMax ELISA Kit

EG3928-1 96 Well Plate
EUR 477

Human Carbonic Anhydrase 1 (CA1) AssayMax ELISA Kit

EC5752-1 96 Well Plate
EUR 477

Human Alpha-1-Antitrypsin (A1AT) AssayMax ELISA Kit

EA5001-1 96 Well Plate
EUR 417

Human Alpha-1-Antitrypsin (A1AT) AssayMax ELISA Kit

EA5101-1 96 Well Plate
EUR 417

Human Alpha-1-Antichymotrypsin (AACT) AssayMax ELISA Kit

EA5501-1 96 Well Plate
EUR 417

Human Estrogen Sulfotransferase (EST-1) AssayMax ELISA Kit

EE2702-1 96 Well Plate
EUR 477

Human Alpha-1-Microglobulin (A1M) AssayMax ELISA Kit

EM5110-1 96 Well Plate
EUR 396

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Human MMRN1(Multimerin 1) ELISA Kit