Human MMRN1(Multimerin 1) ELISA Kit
Human Multimerin 1 (MMRN1) ELISA Kit |
RD-MMRN1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Multimerin 1 (MMRN1) ELISA Kit |
RD-MMRN1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Multimerin 1 (MMRN1) ELISA Kit |
RDR-MMRN1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Multimerin 1 (MMRN1) ELISA Kit |
RDR-MMRN1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Rat Multimerin 1 (MMRN1) ELISA Kit |
DLR-MMRN1-Ra-48T |
DL Develop |
48T |
EUR 549 |
- Should the Rat Multimerin 1 (MMRN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Multimerin 1 (MMRN1) in samples from tissue homogenates or other biological fluids. |
Rat Multimerin 1 (MMRN1) ELISA Kit |
DLR-MMRN1-Ra-96T |
DL Develop |
96T |
EUR 718 |
- Should the Rat Multimerin 1 (MMRN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Multimerin 1 (MMRN1) in samples from tissue homogenates or other biological fluids. |
Rat Multimerin 1 (MMRN1) ELISA Kit |
RD-MMRN1-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Rat Multimerin 1 (MMRN1) ELISA Kit |
RD-MMRN1-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 775 |
Rat Multimerin 1 (MMRN1) ELISA Kit |
RDR-MMRN1-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 583 |
Rat Multimerin 1 (MMRN1) ELISA Kit |
RDR-MMRN1-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 811 |
Human MMRN1(Multimerin 1) ELISA Kit |
EH3374 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 78.125-5000 pg/ml
- Uniprot ID: Q13201
- Alias: MMRN1/Multimerin 1
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.875pg/ml |
Human Multimerin 1 (MMRN1) ELISA Kit |
20-abx152404 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Multimerin 1 (MMRN1) ELISA Kit |
abx252769-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Multimerin-1(MMRN1) ELISA kit |
CSB-EL014680HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Multimerin-1 (MMRN1) in samples from serum, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Multimerin-1(MMRN1) ELISA kit |
1-CSB-EL014680HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Multimerin-1(MMRN1) in samples from serum, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human Multimerin 1 (MMRN1) ELISA Kit |
SEC622Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Multimerin 1 (MMRN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Multimerin 1 (MMRN1) in serum, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Multimerin 1 (MMRN1) ELISA Kit |
SEC622Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Multimerin 1 (MMRN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Multimerin 1 (MMRN1) in serum, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Multimerin 1 (MMRN1) ELISA Kit |
SEC622Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Multimerin 1 (MMRN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Multimerin 1 (MMRN1) in serum, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Multimerin 1 (MMRN1) ELISA Kit |
SEC622Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Multimerin 1 (MMRN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Multimerin 1 (MMRN1) in serum, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Multimerin 1 (MMRN1) ELISA Kit |
4-SEC622Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Multimerin 1 elisa. Alternative names of the recognized antigen: ECM
- EMILIN4
- GPIa
- MMRN
- Glycoprotein Ia
- Elastin microfibril interface located protein 4
- Endothelial cell multimerin
- Platelet glycoprotein Ia
- 155 kDa platelet multime
- Show more
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Multimerin 1 (MMRN1) in samples from Serum, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Monkey Multimerin 1 (MMRN1) ELISA Kit |
abx360319-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Pig Multimerin 1 (MMRN1) ELISA Kit |
abx362079-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Rabbit Multimerin 1 (MMRN1) ELISA Kit |
abx363306-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Rat Multimerin 1 (MMRN1) ELISA Kit |
20-abx155849 |
Abbexa |
-
EUR 7237.00
-
EUR 3855.00
-
EUR 895.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Chicken Multimerin 1 (MMRN1) ELISA Kit |
abx356857-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Mouse Multimerin-1 (MMRN1) ELISA Kit |
abx389935-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse Multimerin-1(MMRN1) ELISA kit |
CSB-EL014680MO-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse Multimerin-1 (MMRN1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Mouse Multimerin-1(MMRN1) ELISA kit |
1-CSB-EL014680MO |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse Multimerin-1(MMRN1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Rat Multimerin 1 (MMRN1) ELISA Kit |
SEC622Ra-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5124.2 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Multimerin 1 (MMRN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Multimerin 1 (MMRN1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Rat Multimerin 1 (MMRN1) ELISA Kit |
SEC622Ra-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 509.64 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Multimerin 1 (MMRN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Multimerin 1 (MMRN1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Rat Multimerin 1 (MMRN1) ELISA Kit |
SEC622Ra-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 685.2 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Multimerin 1 (MMRN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Multimerin 1 (MMRN1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Rat Multimerin 1 (MMRN1) ELISA Kit |
SEC622Ra-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2783.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Multimerin 1 (MMRN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Multimerin 1 (MMRN1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Rat Multimerin 1 (MMRN1) ELISA Kit |
4-SEC622Ra |
Cloud-Clone |
-
EUR 5175.00
-
EUR 2734.00
-
EUR 686.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Multimerin 1 elisa. Alternative names of the recognized antigen: ECM
- EMILIN4
- GPIa
- MMRN
- Glycoprotein Ia
- Elastin microfibril interface located protein 4
- Endothelial cell multimerin
- Platelet glycoprotein Ia
- 155 kDa platelet multime
- Show more
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Multimerin 1 (MMRN1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Multimerin 1 (MMRN1) Antibody |
20-abx101098 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Multimerin 1 (MMRN1) Antibody |
20-abx101099 |
Abbexa |
-
EUR 453.00
-
EUR 133.00
-
EUR 1302.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Multimerin 1 (MMRN1) Antibody |
20-abx005104 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Multimerin 1 (MMRN1) Antibody |
20-abx029271 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Multimerin 1 (MMRN1) Antibody |
abx029271-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Multimerin 1 (MMRN1) Antibody |
20-abx173637 |
Abbexa |
|
|
|
Multimerin 1 (MMRN1) Antibody |
20-abx173638 |
Abbexa |
|
|
|
Recombinant Multimerin 1 (MMRN1) |
4-RPC622Hu01 |
Cloud-Clone |
-
EUR 503.20
-
EUR 238.00
-
EUR 1612.00
-
EUR 604.00
-
EUR 1108.00
-
EUR 400.00
-
EUR 3880.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q13201
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 29.6kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Multimerin 1 expressed in: E.coli |
Recombinant Multimerin 1 (MMRN1) |
4-RPC622Ra01 |
Cloud-Clone |
-
EUR 530.08
-
EUR 245.00
-
EUR 1712.80
-
EUR 637.60
-
EUR 1175.20
-
EUR 418.00
-
EUR 4132.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: D4A3E0
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 27.7kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Rat Multimerin 1 expressed in: E.coli |
ELISA kit for Human MMRN1 (Multimerin 1) |
ELK3228 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Multimerin 1 (MMRN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Multimerin 1
- Show more
|
Description: A sandwich ELISA kit for detection of Multimerin 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Human MMRN1 (Multimerin 1) |
E-EL-H0578 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's MMRN1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human MMRN1. Standards or samples are added to the micro ELISA plate wells and combined with
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Human MMRN1 (Multimerin 1) in samples from Serum, Plasma, Cell supernatant |
ELISA kit for Human Multimerin-1 (MMRN1) |
KTE61584-48T |
Abbkine |
48T |
EUR 332 |
- Multimerin is a massive, soluble protein found in platelets and in the endothelium of blood vessels. It is comprised of subunits linked by interchain disulfide bonds to form large, variably sized homomultimers. Multimerin is a factor V/Va-binding pro
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Multimerin-1 (MMRN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Multimerin-1 (MMRN1) |
KTE61584-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Multimerin is a massive, soluble protein found in platelets and in the endothelium of blood vessels. It is comprised of subunits linked by interchain disulfide bonds to form large, variably sized homomultimers. Multimerin is a factor V/Va-binding pro
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Multimerin-1 (MMRN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Multimerin-1 (MMRN1) |
KTE61584-96T |
Abbkine |
96T |
EUR 539 |
- Multimerin is a massive, soluble protein found in platelets and in the endothelium of blood vessels. It is comprised of subunits linked by interchain disulfide bonds to form large, variably sized homomultimers. Multimerin is a factor V/Va-binding pro
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Multimerin-1 (MMRN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Human Multimerin 1 (MMRN1) CLIA Kit |
20-abx493803 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Human Multimerin 1 (MMRN1) CLIA Kit |
abx197315-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Human Multimerin 1 (MMRN1) Protein |
20-abx068116 |
Abbexa |
-
EUR 704.00
-
EUR 286.00
-
EUR 2165.00
-
EUR 829.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
ELISA kit for Rat MMRN1 (Multimerin 1) |
ELK6727 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Multimerin 1 (MMRN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Multimerin 1
- Show more
|
Description: A sandwich ELISA kit for detection of Multimerin 1 from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Mouse Multimerin-1 (MMRN1) |
KTE70995-48T |
Abbkine |
48T |
EUR 332 |
- Multimerin is a massive, soluble protein found in platelets and in the endothelium of blood vessels. It is comprised of subunits linked by interchain disulfide bonds to form large, variably sized homomultimers. Multimerin is a factor V/Va-binding pro
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Multimerin-1 (MMRN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Multimerin-1 (MMRN1) |
KTE70995-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Multimerin is a massive, soluble protein found in platelets and in the endothelium of blood vessels. It is comprised of subunits linked by interchain disulfide bonds to form large, variably sized homomultimers. Multimerin is a factor V/Va-binding pro
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Multimerin-1 (MMRN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Multimerin-1 (MMRN1) |
KTE70995-96T |
Abbkine |
96T |
EUR 539 |
- Multimerin is a massive, soluble protein found in platelets and in the endothelium of blood vessels. It is comprised of subunits linked by interchain disulfide bonds to form large, variably sized homomultimers. Multimerin is a factor V/Va-binding pro
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Multimerin-1 (MMRN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Mmrn1 ELISA Kit| Mouse Multimerin-1 ELISA Kit |
EF015574 |
Lifescience Market |
96 Tests |
EUR 689 |
Rat Multimerin 1 (MMRN1) CLIA Kit |
20-abx493804 |
Abbexa |
-
EUR 8569.00
-
EUR 4560.00
-
EUR 1052.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Rat Multimerin 1 (MMRN1) Protein |
20-abx068117 |
Abbexa |
-
EUR 732.00
-
EUR 286.00
-
EUR 2305.00
-
EUR 885.00
-
EUR 523.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Multimerin 1 (MMRN1) Antibody (FITC) |
20-abx274645 |
Abbexa |
-
EUR 481.00
-
EUR 244.00
-
EUR 1414.00
-
EUR 662.00
-
EUR 356.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Multimerin 1 (MMRN1) Antibody Pair |
20-abx370368 |
Abbexa |
|
-
10 × 96 tests
-
5 × 96 tests
|
- Shipped within 5-15 working days.
|
Multimerin 1 (MMRN1) Antibody Pair |
20-abx370373 |
Abbexa |
|
-
10 × 96 tests
-
5 × 96 tests
|
- Shipped within 5-15 working days.
|
CLIA kit for Human MMRN1 (Multimerin 1) |
E-CL-H0448 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 584 |
- Gentaur's MMRN1 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human MMRN1 . Standards or samples are added to the micro CLIA plate wells and combined with th
- Show more
|
Description: A sandwich CLIA kit for quantitative measurement of Human MMRN1 (Multimerin 1) in samples from Serum, Plasma, Cell supernatant |
Multimerin 1 (MMRN1) Polyclonal Antibody (Human) |
4-PAC622Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MMRN1 (Ala807~Gly1053)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Multimerin 1 (MMRN1) |
Multimerin 1 (MMRN1) Polyclonal Antibody (Rat) |
4-PAC622Ra01 |
Cloud-Clone |
-
EUR 259.00
-
EUR 2708.00
-
EUR 670.00
-
EUR 328.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MMRN1 (Gln846~Ala1084)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Multimerin 1 (MMRN1) |
Multimerin 1 (MMRN1) Polyclonal Antibody (Human), APC |
4-PAC622Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MMRN1 (Ala807~Gly1053)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Multimerin 1 (MMRN1). This antibody is labeled with APC. |
Multimerin 1 (MMRN1) Polyclonal Antibody (Human), Biotinylated |
4-PAC622Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MMRN1 (Ala807~Gly1053)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Multimerin 1 (MMRN1). This antibody is labeled with Biotin. |
Multimerin 1 (MMRN1) Polyclonal Antibody (Human), Cy3 |
4-PAC622Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MMRN1 (Ala807~Gly1053)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Multimerin 1 (MMRN1). This antibody is labeled with Cy3. |
Multimerin 1 (MMRN1) Polyclonal Antibody (Human), FITC |
4-PAC622Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MMRN1 (Ala807~Gly1053)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Multimerin 1 (MMRN1). This antibody is labeled with FITC. |
Multimerin 1 (MMRN1) Polyclonal Antibody (Human), HRP |
4-PAC622Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MMRN1 (Ala807~Gly1053)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Multimerin 1 (MMRN1). This antibody is labeled with HRP. |
Multimerin 1 (MMRN1) Polyclonal Antibody (Human), PE |
4-PAC622Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MMRN1 (Ala807~Gly1053)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Multimerin 1 (MMRN1). This antibody is labeled with PE. |
Multimerin 1 (MMRN1) Polyclonal Antibody (Human), APC-Cy7 |
4-PAC622Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MMRN1 (Ala807~Gly1053)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Multimerin 1 (MMRN1). This antibody is labeled with APC-Cy7. |
Multimerin 1 (MMRN1) Polyclonal Antibody (Rat), APC |
4-PAC622Ra01-APC |
Cloud-Clone |
-
EUR 364.00
-
EUR 3545.00
-
EUR 980.00
-
EUR 467.00
-
EUR 227.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MMRN1 (Gln846~Ala1084)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Multimerin 1 (MMRN1). This antibody is labeled with APC. |
Multimerin 1 (MMRN1) Polyclonal Antibody (Rat), Biotinylated |
4-PAC622Ra01-Biotin |
Cloud-Clone |
-
EUR 325.00
-
EUR 2658.00
-
EUR 777.00
-
EUR 400.00
-
EUR 225.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MMRN1 (Gln846~Ala1084)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Multimerin 1 (MMRN1). This antibody is labeled with Biotin. |
Multimerin 1 (MMRN1) Polyclonal Antibody (Rat), Cy3 |
4-PAC622Ra01-Cy3 |
Cloud-Clone |
-
EUR 444.00
-
EUR 4685.00
-
EUR 1265.00
-
EUR 581.00
-
EUR 261.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MMRN1 (Gln846~Ala1084)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Multimerin 1 (MMRN1). This antibody is labeled with Cy3. |
Multimerin 1 (MMRN1) Polyclonal Antibody (Rat), FITC |
4-PAC622Ra01-FITC |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MMRN1 (Gln846~Ala1084)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Multimerin 1 (MMRN1). This antibody is labeled with FITC. |
Multimerin 1 (MMRN1) Polyclonal Antibody (Rat), HRP |
4-PAC622Ra01-HRP |
Cloud-Clone |
-
EUR 332.00
-
EUR 3089.00
-
EUR 866.00
-
EUR 421.00
-
EUR 213.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MMRN1 (Gln846~Ala1084)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Multimerin 1 (MMRN1). This antibody is labeled with HRP. |
Multimerin 1 (MMRN1) Polyclonal Antibody (Rat), PE |
4-PAC622Ra01-PE |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MMRN1 (Gln846~Ala1084)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Multimerin 1 (MMRN1). This antibody is labeled with PE. |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
Multimerin 1 (MMRN1) Polyclonal Antibody (Rat), APC-Cy7 |
4-PAC622Ra01-APC-Cy7 |
Cloud-Clone |
-
EUR 608.00
-
EUR 6970.00
-
EUR 1840.00
-
EUR 814.00
-
EUR 335.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MMRN1 (Gln846~Ala1084)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Multimerin 1 (MMRN1). This antibody is labeled with APC-Cy7. |
Human Multimerin 2 (MMRN2) ELISA Kit |
20-abx152405 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Multimerin 2 (MMRN2) ELISA Kit |
DLR-MMRN2-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Multimerin 2 (MMRN2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Multimerin 2 (MMRN2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Multimerin 2 (MMRN2) ELISA Kit |
DLR-MMRN2-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Multimerin 2 (MMRN2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Multimerin 2 (MMRN2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Multimerin-2(MMRN2) ELISA kit |
CSB-EL014681HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Multimerin-2 (MMRN2) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Multimerin-2(MMRN2) ELISA kit |
1-CSB-EL014681HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Multimerin-2(MMRN2) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human Multimerin 2 (MMRN2) ELISA Kit |
RD-MMRN2-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Multimerin 2 (MMRN2) ELISA Kit |
RD-MMRN2-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Multimerin 2 (MMRN2) ELISA Kit |
RDR-MMRN2-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Multimerin 2 (MMRN2) ELISA Kit |
RDR-MMRN2-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Multimerin 2 (MMRN2) ELISA Kit |
SEF593Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Multimerin 2 (MMRN2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Multimerin 2 (MMRN2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Multimerin 2 (MMRN2) ELISA Kit |
SEF593Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Multimerin 2 (MMRN2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Multimerin 2 (MMRN2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Multimerin 2 (MMRN2) ELISA Kit |
SEF593Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Multimerin 2 (MMRN2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Multimerin 2 (MMRN2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Multimerin 2 (MMRN2) ELISA Kit |
SEF593Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Multimerin 2 (MMRN2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Multimerin 2 (MMRN2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Multimerin 2 (MMRN2) ELISA Kit |
4-SEF593Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Multimerin 2 elisa. Alternative names of the recognized antigen: EMILIN3
- EndoGlyx-1
- Elastin Microfibril Interfacer 3
- Elastin microfibril interface located protein 3
- EndoGlyx-1 p125/p140 subunit
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Multimerin 2 (MMRN2) in samples from Serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species. |
ELISA kit for Human MMRN2 (Multimerin 2) |
ELK4130 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Multimerin 2 (MMRN2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Multimerin 2
- Show more
|
Description: A sandwich ELISA kit for detection of Multimerin 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Human Multimerin-2 (MMRN2) |
KTE61583-48T |
Abbkine |
48T |
EUR 332 |
- MMRN2 encodes a protein belonging to the member of elastin microfibril interface-located (EMILIN) protein family. This family member is an extracellular matrix glycoprotein that can interfere with tumor angiogenesis and growth. It serves as a transfo
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Multimerin-2 (MMRN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Multimerin-2 (MMRN2) |
KTE61583-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- MMRN2 encodes a protein belonging to the member of elastin microfibril interface-located (EMILIN) protein family. This family member is an extracellular matrix glycoprotein that can interfere with tumor angiogenesis and growth. It serves as a transfo
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Multimerin-2 (MMRN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Multimerin-2 (MMRN2) |
KTE61583-96T |
Abbkine |
96T |
EUR 539 |
- MMRN2 encodes a protein belonging to the member of elastin microfibril interface-located (EMILIN) protein family. This family member is an extracellular matrix glycoprotein that can interfere with tumor angiogenesis and growth. It serves as a transfo
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Multimerin-2 (MMRN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
MMRN1 siRNA |
20-abx924332 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MMRN1 siRNA |
20-abx924333 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MMRN1 antibody |
39078-100ul |
SAB |
100ul |
EUR 252 |
anti-MMRN1 |
YF-PA25811 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to MMRN1 |
Mouse Multimerin 2 (MMRN2) ELISA Kit |
20-abx154418 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Mouse Multimerin 2 (MMRN2) ELISA Kit |
DLR-MMRN2-Mu-48T |
DL Develop |
48T |
EUR 527 |
- Should the Mouse Multimerin 2 (MMRN2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Multimerin 2 (MMRN2) in samples from tissue homogenates or other biological fluids. |
Mouse Multimerin 2 (MMRN2) ELISA Kit |
DLR-MMRN2-Mu-96T |
DL Develop |
96T |
EUR 688 |
- Should the Mouse Multimerin 2 (MMRN2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Multimerin 2 (MMRN2) in samples from tissue homogenates or other biological fluids. |
Mouse Multimerin 2 (MMRN2) ELISA Kit |
RD-MMRN2-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 533 |
Mouse Multimerin 2 (MMRN2) ELISA Kit |
RD-MMRN2-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 740 |
Mouse Multimerin 2 (MMRN2) ELISA Kit |
RDR-MMRN2-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Mouse Multimerin 2 (MMRN2) ELISA Kit |
RDR-MMRN2-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 774 |
Mouse Multimerin 2 (MMRN2) ELISA Kit |
SEF593Mu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4862.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Multimerin 2 (MMRN2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Multimerin 2 (MMRN2) in Tissue homogenates and other biological fluids. |
Mouse Multimerin 2 (MMRN2) ELISA Kit |
SEF593Mu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 488.08 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Multimerin 2 (MMRN2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Multimerin 2 (MMRN2) in Tissue homogenates and other biological fluids. |
Mouse Multimerin 2 (MMRN2) ELISA Kit |
SEF593Mu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 654.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Multimerin 2 (MMRN2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Multimerin 2 (MMRN2) in Tissue homogenates and other biological fluids. |
Mouse Multimerin 2 (MMRN2) ELISA Kit |
SEF593Mu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2644.8 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Multimerin 2 (MMRN2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Multimerin 2 (MMRN2) in Tissue homogenates and other biological fluids. |
Mouse Multimerin 2 (MMRN2) ELISA Kit |
4-SEF593Mu |
Cloud-Clone |
-
EUR 4913.00
-
EUR 2595.00
-
EUR 655.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Multimerin 2 elisa. Alternative names of the recognized antigen: EMILIN3
- EndoGlyx-1
- Elastin Microfibril Interfacer 3
- Elastin microfibril interface located protein 3
- EndoGlyx-1 p125/p140 subunit
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Multimerin 2 (MMRN2) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody |
EXOAB-KIT-1 |
SBI |
25 ul each |
EUR 627 |
|
mRNAExpress mRNA Synthesis kit (5 reactions) |
MR-KIT-1 |
SBI |
5 reactions |
EUR 1152 |
- Category: Stem Cell Products
|
PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN320A-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN340iPS-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
Human MMRN1 shRNA Plasmid |
20-abx957868 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human Multimerin 2 (MMRN2) CLIA Kit |
20-abx494958 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
MMRN1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1313202 |
ABM |
1.0 ug DNA |
EUR 154 |
ELISA kit for Mouse MMRN2 (Multimerin 2) |
ELK6348 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Multimerin 2 (MMRN2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Multimerin 2
- Show more
|
Description: A sandwich ELISA kit for detection of Multimerin 2 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Mouse Multimerin-2 (MMRN2) |
KTE70994-48T |
Abbkine |
48T |
EUR 332 |
- MMRN2 encodes a protein belonging to the member of elastin microfibril interface-located (EMILIN) protein family. This family member is an extracellular matrix glycoprotein that can interfere with tumor angiogenesis and growth. It serves as a transfo
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Multimerin-2 (MMRN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Multimerin-2 (MMRN2) |
KTE70994-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- MMRN2 encodes a protein belonging to the member of elastin microfibril interface-located (EMILIN) protein family. This family member is an extracellular matrix glycoprotein that can interfere with tumor angiogenesis and growth. It serves as a transfo
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Multimerin-2 (MMRN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Multimerin-2 (MMRN2) |
KTE70994-96T |
Abbkine |
96T |
EUR 539 |
- MMRN2 encodes a protein belonging to the member of elastin microfibril interface-located (EMILIN) protein family. This family member is an extracellular matrix glycoprotein that can interfere with tumor angiogenesis and growth. It serves as a transfo
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Multimerin-2 (MMRN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
MMRN1 Conjugated Antibody |
C39078 |
SAB |
100ul |
EUR 397 |
MMRN1 Rabbit pAb |
A6658-100ul |
Abclonal |
100 ul |
EUR 308 |
MMRN1 Rabbit pAb |
A6658-200ul |
Abclonal |
200 ul |
EUR 459 |
MMRN1 Rabbit pAb |
A6658-20ul |
Abclonal |
20 ul |
EUR 183 |
MMRN1 Rabbit pAb |
A6658-50ul |
Abclonal |
50 ul |
EUR 223 |
MMRN1 cloning plasmid |
CSB-CL622645HU-10ug |
Cusabio |
10ug |
EUR 1301 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 3687
- Sequence: atgaagggggcaagattatttgtccttctttctagtttatggagtgggggcattgggcttaacaacagtaagcattcttggactatacctgaggatgggaactctcagaagactatgccttctgcttcagttcctccaaataaaatacaaagtttgcaaatactgccaaccactc
- Show more
|
Description: A cloning plasmid for the MMRN1 gene. |
Anti-MMRN1 antibody |
STJ28741 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: Multimerin is a massive, soluble protein found in platelets and in the endothelium of blood vessels. It is comprised of subunits linked by interchain disulfide bonds to form large, variably sized homomultimers. Multimerin is a factor V/Va-binding protein and may function as a carrier protein for platelet factor V. It may also have functions as an extracellular matrix or adhesive protein. Recently, patients with an unusual autosomal-dominant bleeding disorder (factor V Quebec) were found to have a deficiency of platelet multimerin. |
Anti-MMRN1 (1G10) |
YF-MA17756 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to MMRN1 |
Anti-MMRN1 (4B9) |
YF-MA11372 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to MMRN1 |
PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN300A-KIT |
SBI |
1 Kit |
EUR 2798 |
- Category: PinPoint Integrase Tools
|
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents) |
CAS510A-KIT |
SBI |
1 Kit |
EUR 805 |
|
PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN400A-KIT |
SBI |
1 Kit |
EUR 2798 |
- Category: PinPoint Integrase Tools
|
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN410A-KIT |
SBI |
1 Kit |
EUR 4335 |
- Category: PinPoint Integrase Tools
|
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN412A-KIT |
SBI |
1 Kit |
EUR 4335 |
- Category: PinPoint Integrase Tools
|
MMRN1 ORF Vector (Human) (pORF) |
ORF006551 |
ABM |
1.0 ug DNA |
EUR 95 |
Human Multimerin 2 (MMRN2) Protein |
20-abx654417 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS |
AP-STR-KIT-1 |
CORNING |
1/pk |
EUR 355 |
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller |
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
Mouse Multimerin 2 (MMRN2) CLIA Kit |
20-abx494959 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Column Packing Kit |
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
Human Glutaredoxin-1 AssayMax ELISA Kit |
EG2153-1 |
AssayPro |
96 Well Plate |
EUR 417 |
Human Complexin-1 AssayMax ELISA Kit |
EC3505-1 |
AssayPro |
96 Well Plate |
EUR 417 |
Human Hexokinase-1 AssayMax ELISA Kit |
EH3101-1 |
AssayPro |
96 Well Plate |
EUR 477 |
PCR Mycoplasma Detection Kit |
M034-Kit |
TOKU-E |
Kit |
EUR 266 |
Mouse MMRN1 shRNA Plasmid |
20-abx977329 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Multimerin 2 (MMRN2) Antibody |
20-abx129433 |
Abbexa |
-
EUR 439.00
-
EUR 133.00
-
EUR 1233.00
-
EUR 592.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Multimerin 2 (MMRN2) Antibody |
abx027169-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Multimerin 2 (MMRN2) Antibody |
abx027169-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Multimerin 2 (MMRN2) Antibody |
20-abx173639 |
Abbexa |
|
|
|
Multimerin 2 (MMRN2) Antibody |
20-abx177634 |
Abbexa |
|
|
|
Multimerin 2 (MMRN2) Antibody |
20-abx177635 |
Abbexa |
|
|
|
Recombinant Multimerin 2 (MMRN2) |
4-RPF593Mu01 |
Cloud-Clone |
-
EUR 476.32
-
EUR 230.00
-
EUR 1511.20
-
EUR 570.40
-
EUR 1040.80
-
EUR 382.00
-
EUR 3628.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: A6H6E2
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 22.6kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Mouse Multimerin 2 expressed in: E.coli |
Mmrn1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4093702 |
ABM |
1.0 ug DNA |
EUR 154 |
AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
GE620A-KIT |
SBI |
1 kit |
EUR 2132 |
|
MMRN1 sgRNA CRISPR Lentivector set (Human) |
K1313201 |
ABM |
3 x 1.0 ug |
EUR 339 |
AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
GE622A-KIT |
SBI |
1 kit |
EUR 2132 |
|
AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
GE624A-KIT |
SBI |
1 kit |
EUR 2132 |
|
Human Lipocalin-1 (LCN1) AssayMax ELISA Kit |
EL3502-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Human TGF-beta-1 AssayMax ELISA Kit |
ET3102-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Human PAI-1/tPA AssayMax ELISA Kit |
EP1105-1 |
AssayPro |
96 Well Plate |
EUR 417 |
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit |
CAS400A-KIT |
SBI |
1 kit (10 rxn) |
EUR 1110 |
|
Human KRAB-associated Protein 1 (KAP-1) AssayMax ELISA Kit |
EK2802-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Human Interleukin-1 beta (IL-1 beta) AssayMax ELISA Kit |
EI2200-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Human Interleukin-1-alpha (IL-1-alpha) AssayMax ELISA Kit |
EI2301-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Human Plasminogen Activator Inhibitor-1 (PAI-1) AssayMax ELISA Kit |
EP1100-1 |
AssayPro |
96 Well Plate |
EUR 417 |
CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV100PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV105PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV120PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV125PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Human Glutathione Transferase zeta 1 AssayMax ELISA Kit |
EG2350-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Human Glutathione Peroxidase 1 (GPX1) AssayMax ELISA Kit |
EG3928-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Human Carbonic Anhydrase 1 (CA1) AssayMax ELISA Kit |
EC5752-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Human Alpha-1-Antitrypsin (A1AT) AssayMax ELISA Kit |
EA5001-1 |
AssayPro |
96 Well Plate |
EUR 417 |
Human Alpha-1-Antitrypsin (A1AT) AssayMax ELISA Kit |
EA5101-1 |
AssayPro |
96 Well Plate |
EUR 417 |
Human Alpha-1-Antichymotrypsin (AACT) AssayMax ELISA Kit |
EA5501-1 |
AssayPro |
96 Well Plate |
EUR 417 |
Human Estrogen Sulfotransferase (EST-1) AssayMax ELISA Kit |
EE2702-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Human Alpha-1-Microglobulin (A1M) AssayMax ELISA Kit |
EM5110-1 |
AssayPro |
96 Well Plate |
EUR 396 |
Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS700A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Human MMRN1(Multimerin 1) ELISA Kit