Human MUTYH(MutY Homolog) ELISA Kit

Notice: Trying to access array offset on value of type bool in /home/fwsoeulh/domains/micca.org/public_html/wp-content/plugins/gentaur-linking/app/Libs/LSPDRequest.php on line 194

Notice: Trying to access array offset on value of type bool in /home/fwsoeulh/domains/micca.org/public_html/wp-content/plugins/gentaur-linking/app/Libs/LSPDRequest.php on line 208

Notice: Trying to access array offset on value of type bool in /home/fwsoeulh/domains/micca.org/public_html/wp-content/plugins/gentaur-linking/app/Libs/LSPDRequest.php on line 229

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/micca.org/public_html/wp-content/plugins/gentaur-linking/vendor_prefixed/pwpf/src/View/View.php on line 103

Human MUTYH(MutY Homolog) ELISA Kit

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/micca.org/public_html/wp-content/plugins/gentaur-linking/vendor_prefixed/pwpf/src/View/View.php on line 64

Human MutY Homolog (MUTYH) ELISA Kit
RDR-MUTYH-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human MutY Homolog (MUTYH) ELISA Kit
RDR-MUTYH-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human MutY Homolog (MUTYH) ELISA Kit
RD-MUTYH-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human MutY Homolog (MUTYH) ELISA Kit
RD-MUTYH-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human MutY Homolog (MUTYH)ELISA Kit
201-12-2943	SunredBio	96 tests	EUR 440
This MutY Homolog ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human MutY Homolog (MUTYH) ELISA Kit
20-abx152408	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human MutY Homolog(MUTYH)ELISA Kit
QY-E04792	Qayee Biotechnology	96T	EUR 361

Human MutY Homolog (MUTYH) ELISA Kit
SEJ746Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human MutY Homolog (MUTYH) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human MutY Homolog (MUTYH) in Tissue homogenates and other biological fluids.

Human MutY Homolog (MUTYH) ELISA Kit
SEJ746Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human MutY Homolog (MUTYH) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human MutY Homolog (MUTYH) in Tissue homogenates and other biological fluids.

Human MutY Homolog (MUTYH) ELISA Kit
SEJ746Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human MutY Homolog (MUTYH) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human MutY Homolog (MUTYH) in Tissue homogenates and other biological fluids.

Human MutY Homolog (MUTYH) ELISA Kit
SEJ746Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human MutY Homolog (MUTYH) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human MutY Homolog (MUTYH) in Tissue homogenates and other biological fluids.

Human MutY Homolog (MUTYH) ELISA Kit
4-SEJ746Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as MutY Homolog elisa. Alternative names of the recognized antigen: MYH A/G-specific adenine DNA glycosylase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human MutY Homolog (MUTYH) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

MutY Homolog (MUTYH) Antibody
20-abx007479	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

MutY Homolog (MUTYH) Antibody
20-abx210362	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

MutY Homolog (MUTYH) Antibody
20-abx210393	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

MutY Homolog (MUTYH) Antibody
20-abx113900	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

MutY Homolog (MUTYH) Antibody
20-abx131355	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

MutY Homolog (MUTYH) Antibody
20-abx173642	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

MutY Homolog (MUTYH) Antibody
abx034253-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

MutY Homolog (MUTYH) Antibody
abx034253-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

MutY Homolog (MUTYH) Antibody
20-abx321559	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

MutY Homolog (MUTYH) Antibody
abx235445-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

MutY Homolog (MUTYH) Antibody
abx235446-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

MutY Homolog (MUTYH) Antibody
20-abx329277	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

MutY Homolog (MUTYH) Antibody
abx432999-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

MutY Homolog (MUTYH) Antibody
20-abx001356	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

MutY Homolog (MUTYH) Antibody
20-abx001845	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

Recombinant MutY Homolog (MUTYH)
4-RPJ746Hu01	Cloud-Clone	EUR 485.28 EUR 233.00 EUR 1544.80 EUR 581.60 EUR 1063.20 EUR 388.00 EUR 3712.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9UIF7 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 25.2kDa Isoelectric Point: Inquire
Description: Recombinant Human MutY Homolog expressed in: E.coli

Human MutY Homolog (MUTYH) Protein
20-abx650770	Abbexa	EUR 676.00 EUR 286.00 EUR 2082.00 EUR 801.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human MutY Homolog (MUTYH) CLIA Kit
20-abx495775	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Human MUTYH (MutY Homolog)
ELK3240	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to MutY Homolog (MUTYH). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to MutY Homolog Show more
Description: A sandwich ELISA kit for detection of MutY Homolog from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

MutY Homolog (MUTYH) Polyclonal Antibody (Human)
4-PAJ746Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MUTYH (Gly351~Ala544) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human MutY Homolog (MUTYH)

MutY Homolog (MUTYH) Polyclonal Antibody (Human), APC
4-PAJ746Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MUTYH (Gly351~Ala544) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human MutY Homolog (MUTYH). This antibody is labeled with APC.

MutY Homolog (MUTYH) Polyclonal Antibody (Human), Biotinylated
4-PAJ746Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MUTYH (Gly351~Ala544) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human MutY Homolog (MUTYH). This antibody is labeled with Biotin.

MutY Homolog (MUTYH) Polyclonal Antibody (Human), Cy3
4-PAJ746Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MUTYH (Gly351~Ala544) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human MutY Homolog (MUTYH). This antibody is labeled with Cy3.

MutY Homolog (MUTYH) Polyclonal Antibody (Human), FITC
4-PAJ746Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MUTYH (Gly351~Ala544) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human MutY Homolog (MUTYH). This antibody is labeled with FITC.

MutY Homolog (MUTYH) Polyclonal Antibody (Human), HRP
4-PAJ746Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MUTYH (Gly351~Ala544) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human MutY Homolog (MUTYH). This antibody is labeled with HRP.

MutY Homolog (MUTYH) Polyclonal Antibody (Human), PE
4-PAJ746Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MUTYH (Gly351~Ala544) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human MutY Homolog (MUTYH). This antibody is labeled with PE.

MutY Homolog (MUTYH) Polyclonal Antibody (Human), APC-Cy7
4-PAJ746Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MUTYH (Gly351~Ala544) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human MutY Homolog (MUTYH). This antibody is labeled with APC-Cy7.

Mutyh/ Rat Mutyh ELISA Kit
ELI-38608r	Lifescience Market	96 Tests	EUR 886

Rabbit Anti-Human MutY Homolog ab #1
MUTY11-S	Alpha Diagnostics	100 ul	EUR 457

Human MutY homolog Control/blocking peptide #2
MUTY12-P	Alpha Diagnostics	100 ug	EUR 164

MUTYH ELISA KIT|Human
EF001008	Lifescience Market	96 Tests	EUR 689

Rabbit Anti-Human MutY homolog peptide ab #2
MUTY12-S	Alpha Diagnostics	100 ul	EUR 457

MUTYH ELISA Kit (Human) (OKCD00581)
OKCD00581	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: Involved in oxidative DNA damage repair. Initiates repair of A*oxoG to C*G by removing the inappropriately paired adenine base from the DNA backbone. Possesses both adenine and 2-OH-A DNA glycosylase activities.1 Publication <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.2"Identification of human MutY homolog (hMYH) as a repair enzyme for 2-hydroxyadenine in DNA and detection of multiple forms of hMYH located in nuclei and mitochondria."_x005F_x005F_x000D_Ohtsubo T., Nishioka K., Imaiso Y., Iwai S., Shimokawa H., Oda H., Fujikawa T., Nakabeppu Y._x005F_x005F_x000D_Nucleic Acids Res. 28:1355-1364(2000) [PubMed] [Europe PMC] [Abstract]Cited for: NUCLEOTIDE SEQUENCE [MRNA] (ISOFORMS ALPHA-1; ALPHA-2; ALPHA-3; BETA-1; GAMMA-2 AND GAMMA-3), FUNCTION. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.057 ng/mL

MUTYH ELISA Kit (Human) (OKDD00409)
OKDD00409	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: This gene encodes a DNA glycosylase involved in oxidative DNA damage repair. The enzyme excises adenine bases from the DNA backbone at sites where adenine is inappropriately paired with guanine, cytosine, or 8-oxo-7,8-dihydroguanine, a major oxidatively damaged DNA lesion. The protein is localized to the nucleus and mitochondria. Mutations in this gene result in heritable predisposition to colon and stomach cancer. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.041 ng/mL

Rabbit Anti-Human MutY homolog peptide IgG #2, aff. Pure
MUTY12-A	Alpha Diagnostics	100 ug	EUR 482

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

MUTYH Antibody
31101-100ul	SAB	100ul	EUR 252

MUTYH Antibody
31101-50ul	SAB	50ul	EUR 187

MUTYH antibody
70R-18684	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal MUTYH antibody

MUTYH antibody
38267-100ul	SAB	100ul	EUR 252

MUTYH Antibody
1-CSB-PA003342	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against MUTYH. Recognizes MUTYH from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000

MUTYH Antibody
1-CSB-PA883426ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against MUTYH. Recognizes MUTYH from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

MUTYH Antibody
DF6500	Affbiotech	200ul	EUR 304
Description: MUTYH Antibody detects endogenous levels of total MUTYH.

MUTYH Antibody
1-CSB-PA029874	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MUTYH. Recognizes MUTYH from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:25-1:100

MUTYH Antibody
1-CSB-PA242639	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MUTYH. Recognizes MUTYH from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:50-1:200

MUTYH Antibody
1-CSB-PA015245GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against MUTYH. Recognizes MUTYH from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

MUTYH antibody
70R-51594	Fitzgerald	100 ul	EUR 244
Description: Purified Polyclonal MUTYH antibody

MUTYH antibody
70R-33839	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal MUTYH antibody

MUTYH Antibody
AF0379	Affbiotech	200ul	EUR 304
Description: MUTYH antibody detects endogenous levels of total MUTYH.

MUTYH siRNA
20-abx903397	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MUTYH siRNA
20-abx925057	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MUTYH siRNA
20-abx925058	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MUTYH Antibody
ABD6500	Lifescience Market	100 ug	EUR 438

MUTYH Antibody
ABF0379	Lifescience Market	100 ug	EUR 438

Human MUTYH shRNA Plasmid
20-abx953027	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

MUTYH Recombinant Protein (Human)
RP020413	ABM	100 ug	Ask for price

MUTY protein (His tag)
80R-2761	Fitzgerald	10 ug	EUR 322
Description: Purified recombinant MUTY protein (His tag)

Human MutY Control/blocking peptide #1
MUTY11-P	Alpha Diagnostics	100 ug	EUR 164

MUTYH Rabbit pAb
A1612-100ul	Abclonal	100 ul	EUR 308

MUTYH Rabbit pAb
A1612-200ul	Abclonal	200 ul	EUR 459

MUTYH Rabbit pAb
A1612-20ul	Abclonal	20 ul	EUR 183

MUTYH Rabbit pAb
A1612-50ul	Abclonal	50 ul	EUR 223

MUTYH Blocking Peptide
DF6500-BP	Affbiotech	1mg	EUR 195

MUTYH Blocking Peptide
20-abx062169	Abbexa	EUR 272.00 EUR 411.00	1 mg 5 mg
Shipped within 5-10 working days.

MUTYH Blocking Peptide
AF0379-BP	Affbiotech	1mg	EUR 195

MUTYH Conjugated Antibody
C31101	SAB	100ul	EUR 397

MUTYH Conjugated Antibody
C38267	SAB	100ul	EUR 397

MUTYH cloning plasmid
CSB-CL883426HU-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1608 Sequence: atgacaccgctcgtctcccgcctgagtcgtctgtgggccatcatgaggaagccacgagcagccgtgggaagtggtcacaggaagcaggcagccagccaggaagggaggcagaagcatgctaagaacaacagtcaggccaagccttctgcctgtgatggcctggccaggcagccgg Show more
Description: A cloning plasmid for the MUTYH gene.

MUTYH Rabbit pAb
A2265-100ul	Abclonal	100 ul	EUR 308

MUTYH Rabbit pAb
A2265-200ul	Abclonal	200 ul	EUR 459

MUTYH Rabbit pAb
A2265-20ul	Abclonal	20 ul	Ask for price

MUTYH Rabbit pAb
A2265-50ul	Abclonal	50 ul	Ask for price

anti- MUTYH antibody
FNab05445	FN Test	100µg	EUR 505.25
Immunogen: mutY homolog(E. coli) Uniprot ID: Q9UIF7 Gene ID: 4595 Research Area: Metabolism
Description: Antibody raised against MUTYH

anti- MUTYH antibody
FNab05446	FN Test	100µg	EUR 505.25
Immunogen: mutY homolog(E. coli) Uniprot ID: Q9UIF7 Gene ID: 4595 Research Area: Metabolism
Description: Antibody raised against MUTYH

Anti-MUTYH antibody
PAab05445	Lifescience Market	100 ug	EUR 355

Anti-MUTYH antibody
PAab05446	Lifescience Market	100 ug	EUR 355

Anti-MUTYH antibody
STJ24647	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a DNA glycosylase involved in oxidative DNA damage repair. The enzyme excises adenine bases from the DNA backbone at sites where adenine is inappropriately paired with guanine, cytosine, or 8-oxo-7,8-dihydroguanine, a major oxidatively damaged DNA lesion. The protein is localized to the nucleus and mitochondria. This gene product is thought to play a role in signaling apoptosis by the introduction of single-strand breaks following oxidative damage. Mutations in this gene result in heritable predisposition to colorectal cancer, termed MUTYH-associated polyposis (MAP). Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-MUTYH antibody
STJ24648	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a DNA glycosylase involved in oxidative DNA damage repair. The enzyme excises adenine bases from the DNA backbone at sites where adenine is inappropriately paired with guanine, cytosine, or 8-oxo-7,8-dihydroguanine, a major oxidatively damaged DNA lesion. The protein is localized to the nucleus and mitochondria. This gene product is thought to play a role in signaling apoptosis by the introduction of single-strand breaks following oxidative damage. Mutations in this gene result in heritable predisposition to colorectal cancer, termed MUTYH-associated polyposis (MAP). Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-MUTYH antibody
STJ140046	St John's Laboratory	150 µg	EUR 219
Description: polyclonal antibody to MUTYH. MUTYH is involved in oxidative DNA damage repair. It nicks DNA replication errors, specifically A/G mismatches.

Anti-MUTYH antibody
STJ70530	St John's Laboratory	100 µg	EUR 359

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

MUTYH ORF Vector (Human) (pORF)
ORF006805	ABM	1.0 ug DNA	EUR 95

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Recombinant Human MutY Protein for Western blot
MUTY11-C	Alpha Diagnostics	100 ul	EUR 286

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

Human A/G-specific adenine DNA glycosylase(MUTYH) ELISA kit
E01A1924-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human A/G-specific adenine DNA glycosylase(MUTYH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human A/G-specific adenine DNA glycosylase(MUTYH) ELISA kit
E01A1924-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human A/G-specific adenine DNA glycosylase(MUTYH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human A/G-specific adenine DNA glycosylase(MUTYH) ELISA kit
E01A1924-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human A/G-specific adenine DNA glycosylase(MUTYH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human A/G specific adenine DNA glycosylase(MUTYH) ELISA kit
E01A0952-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human A/G specific adenine DNA glycosylase(MUTYH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human A/G specific adenine DNA glycosylase(MUTYH) ELISA kit
E01A0952-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human A/G specific adenine DNA glycosylase(MUTYH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human A/G specific adenine DNA glycosylase(MUTYH) ELISA kit
E01A0952-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human A/G specific adenine DNA glycosylase(MUTYH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human A/G- specific adenine DNA glycosylase, MUTYH ELISA KIT
ELI-38607h	Lifescience Market	96 Tests	EUR 824

Rat MUTYH shRNA Plasmid
20-abx987616	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse MUTYH shRNA Plasmid
20-abx977259	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

MUTYH Recombinant Protein (Mouse)
RP152393	ABM	100 ug	Ask for price

MUTYH Recombinant Protein (Mouse)
RP152396	ABM	100 ug	Ask for price

MUTYH Recombinant Protein (Rat)
RP212819	ABM	100 ug	Ask for price

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

MUTYH sgRNA CRISPR Lentivector set (Human)
K1369401	ABM	3 x 1.0 ug	EUR 339

Rabbit Anti-Human MutY IgG #1, aff pure
MUTY11-A	Alpha Diagnostics	100 ug	EUR 482

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

ELISA kit for Human A/G-specific adenine DNA glycosylase (MUTYH)
KTE62225-48T	Abbkine	48T	EUR 332
MUTYH glycosylase, involved in oxidative DNA damage repair. The enzyme excises adenine bases from the DNA backbone at sites where adenine is inappropriately paired with guanine, cytosine, or 8-oxo-7,8-dihydroguanine, a major oxidatively damaged DNA l Show more
Description: Quantitative sandwich ELISA for measuring Human A/G-specific adenine DNA glycosylase (MUTYH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human A/G-specific adenine DNA glycosylase (MUTYH)
KTE62225-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
MUTYH glycosylase, involved in oxidative DNA damage repair. The enzyme excises adenine bases from the DNA backbone at sites where adenine is inappropriately paired with guanine, cytosine, or 8-oxo-7,8-dihydroguanine, a major oxidatively damaged DNA l Show more
Description: Quantitative sandwich ELISA for measuring Human A/G-specific adenine DNA glycosylase (MUTYH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human A/G-specific adenine DNA glycosylase (MUTYH)
KTE62225-96T	Abbkine	96T	EUR 539
MUTYH glycosylase, involved in oxidative DNA damage repair. The enzyme excises adenine bases from the DNA backbone at sites where adenine is inappropriately paired with guanine, cytosine, or 8-oxo-7,8-dihydroguanine, a major oxidatively damaged DNA l Show more
Description: Quantitative sandwich ELISA for measuring Human A/G-specific adenine DNA glycosylase (MUTYH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Human Snail Homolog ELISA kit
E01S0441-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Snail Homolog in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Snail Homolog ELISA kit
E01S0441-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Snail Homolog in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Snail Homolog ELISA kit
E01S0441-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Snail Homolog in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV200PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV205PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV220PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV225PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS750A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS770A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS790A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]
CAS9LIG-KIT	SBI	1 Kit	EUR 153
Category: Cas9

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

Rat A/G specific adenine DNA glycosylase(MUTYH) ELISA kit
E02A0952-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat A/G specific adenine DNA glycosylase(MUTYH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat A/G specific adenine DNA glycosylase(MUTYH) ELISA kit
E02A0952-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat A/G specific adenine DNA glycosylase(MUTYH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat A/G specific adenine DNA glycosylase(MUTYH) ELISA kit
E02A0952-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat A/G specific adenine DNA glycosylase(MUTYH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat A/G-specific adenine DNA glycosylase(MUTYH) ELISA kit
E02A1924-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat A/G-specific adenine DNA glycosylase(MUTYH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat A/G-specific adenine DNA glycosylase(MUTYH) ELISA kit
E02A1924-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat A/G-specific adenine DNA glycosylase(MUTYH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat A/G-specific adenine DNA glycosylase(MUTYH) ELISA kit
E02A1924-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat A/G-specific adenine DNA glycosylase(MUTYH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit A/G specific adenine DNA glycosylase(MUTYH) ELISA kit
E04A0952-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit A/G specific adenine DNA glycosylase(MUTYH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit A/G specific adenine DNA glycosylase(MUTYH) ELISA kit
E04A0952-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit A/G specific adenine DNA glycosylase(MUTYH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit A/G specific adenine DNA glycosylase(MUTYH) ELISA kit
E04A0952-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit A/G specific adenine DNA glycosylase(MUTYH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat A/G specific adenine DNA glycosylase(MUTYH) ELISA kit
E06A0952-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat A/G specific adenine DNA glycosylase(MUTYH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat A/G specific adenine DNA glycosylase(MUTYH) ELISA kit
E06A0952-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat A/G specific adenine DNA glycosylase(MUTYH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat A/G specific adenine DNA glycosylase(MUTYH) ELISA kit
E06A0952-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat A/G specific adenine DNA glycosylase(MUTYH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat A/G-specific adenine DNA glycosylase(MUTYH) ELISA kit
E06A1924-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat A/G-specific adenine DNA glycosylase(MUTYH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat A/G-specific adenine DNA glycosylase(MUTYH) ELISA kit
E06A1924-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat A/G-specific adenine DNA glycosylase(MUTYH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat A/G-specific adenine DNA glycosylase(MUTYH) ELISA kit
E06A1924-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat A/G-specific adenine DNA glycosylase(MUTYH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse A/G specific adenine DNA glycosylase(MUTYH) ELISA kit
E03A0952-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse A/G specific adenine DNA glycosylase(MUTYH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse A/G specific adenine DNA glycosylase(MUTYH) ELISA kit
E03A0952-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse A/G specific adenine DNA glycosylase(MUTYH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse A/G specific adenine DNA glycosylase(MUTYH) ELISA kit
E03A0952-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse A/G specific adenine DNA glycosylase(MUTYH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse A/G-specific adenine DNA glycosylase(MUTYH) ELISA kit
E03A1924-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse A/G-specific adenine DNA glycosylase(MUTYH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse A/G-specific adenine DNA glycosylase(MUTYH) ELISA kit
E03A1924-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse A/G-specific adenine DNA glycosylase(MUTYH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse A/G-specific adenine DNA glycosylase(MUTYH) ELISA kit
E03A1924-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse A/G-specific adenine DNA glycosylase(MUTYH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit A/G-specific adenine DNA glycosylase(MUTYH) ELISA kit
E04A1924-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit A/G-specific adenine DNA glycosylase(MUTYH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit A/G-specific adenine DNA glycosylase(MUTYH) ELISA kit
E04A1924-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit A/G-specific adenine DNA glycosylase(MUTYH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit A/G-specific adenine DNA glycosylase(MUTYH) ELISA kit
E04A1924-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit A/G-specific adenine DNA glycosylase(MUTYH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig A/G-specific adenine DNA glycosylase(MUTYH) ELISA kit
E07A1924-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine A/G-specific adenine DNA glycosylase(MUTYH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig A/G-specific adenine DNA glycosylase(MUTYH) ELISA kit
E07A1924-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine A/G-specific adenine DNA glycosylase(MUTYH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig A/G-specific adenine DNA glycosylase(MUTYH) ELISA kit
E07A1924-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine A/G-specific adenine DNA glycosylase(MUTYH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog A/G specific adenine DNA glycosylase(MUTYH) ELISA kit
E08A0952-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine A/G specific adenine DNA glycosylase(MUTYH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog A/G specific adenine DNA glycosylase(MUTYH) ELISA kit
E08A0952-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine A/G specific adenine DNA glycosylase(MUTYH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog A/G specific adenine DNA glycosylase(MUTYH) ELISA kit
E08A0952-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine A/G specific adenine DNA glycosylase(MUTYH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey A/G specific adenine DNA glycosylase(MUTYH) ELISA kit
E09A0952-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey A/G specific adenine DNA glycosylase(MUTYH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey A/G specific adenine DNA glycosylase(MUTYH) ELISA kit
E09A0952-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey A/G specific adenine DNA glycosylase(MUTYH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey A/G specific adenine DNA glycosylase(MUTYH) ELISA kit
E09A0952-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey A/G specific adenine DNA glycosylase(MUTYH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog A/G-specific adenine DNA glycosylase(MUTYH) ELISA kit
E08A1924-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine A/G-specific adenine DNA glycosylase(MUTYH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog A/G-specific adenine DNA glycosylase(MUTYH) ELISA kit
E08A1924-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine A/G-specific adenine DNA glycosylase(MUTYH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog A/G-specific adenine DNA glycosylase(MUTYH) ELISA kit
E08A1924-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine A/G-specific adenine DNA glycosylase(MUTYH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig A/G specific adenine DNA glycosylase(MUTYH) ELISA kit
E07A0952-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine A/G specific adenine DNA glycosylase(MUTYH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig A/G specific adenine DNA glycosylase(MUTYH) ELISA kit
E07A0952-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine A/G specific adenine DNA glycosylase(MUTYH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig A/G specific adenine DNA glycosylase(MUTYH) ELISA kit
E07A0952-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine A/G specific adenine DNA glycosylase(MUTYH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey A/G-specific adenine DNA glycosylase(MUTYH) ELISA kit
E09A1924-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey A/G-specific adenine DNA glycosylase(MUTYH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey A/G-specific adenine DNA glycosylase(MUTYH) ELISA kit
E09A1924-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey A/G-specific adenine DNA glycosylase(MUTYH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey A/G-specific adenine DNA glycosylase(MUTYH) ELISA kit
E09A1924-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey A/G-specific adenine DNA glycosylase(MUTYH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse A/G- specific adenine DNA glycosylase, Mutyh ELISA KIT
ELI-44785m	Lifescience Market	96 Tests	EUR 865

MUTYH sgRNA CRISPR Lentivector (Human) (Target 1)
K1369402	ABM	1.0 ug DNA	EUR 154

MUTYH sgRNA CRISPR Lentivector (Human) (Target 2)
K1369403	ABM	1.0 ug DNA	EUR 154

MUTYH sgRNA CRISPR Lentivector (Human) (Target 3)
K1369404	ABM	1.0 ug DNA	EUR 154

MUTYH Protein Vector (Human) (pPB-C-His)
PV027217	ABM	500 ng	EUR 329

MUTYH Protein Vector (Human) (pPB-N-His)
PV027218	ABM	500 ng	EUR 329

MUTYH Protein Vector (Human) (pPM-C-HA)
PV027219	ABM	500 ng	EUR 329

MUTYH Protein Vector (Human) (pPM-C-His)
PV027220	ABM	500 ng	EUR 329

Mutyh ORF Vector (Rat) (pORF)
ORF070941	ABM	1.0 ug DNA	EUR 506

Mutyh ORF Vector (Mouse) (pORF)
ORF050799	ABM	1.0 ug DNA	EUR 506

Mutyh ORF Vector (Mouse) (pORF)
ORF050800	ABM	1.0 ug DNA	EUR 506

MutY Adenine DNA Glycosylase E.Coli Recombinant Protein
PROTP17802	BosterBio	Regular: 5ug	EUR 317
Description: MutY Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 373 amino acids (1-350) and having a molecular mass of 41.5kDa. MutY is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Recombinant other MutY Protein, His, E.coli-1ug
QP12757-1ug	EnQuireBio	1ug	EUR 155

Recombinant other MutY Protein, His, E.coli-50ug
QP12757-50ug	EnQuireBio	50ug	EUR 1161

Recombinant other MutY Protein, His, E.coli-5ug
QP12757-5ug	EnQuireBio	5ug	EUR 201

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE620A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE622A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE624A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

Human Xylulokinase Homolog (XYLB)ELISA Kit
201-12-2623	SunredBio	96 tests	EUR 440
This Xylulokinase Homolog ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Clock Homolog (CLOCK)ELISA Kit
201-12-2901	SunredBio	96 tests	EUR 440
This Clock Homolog ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Clock Homolog (CLOCK) ELISA Kit
DLR-CLOCK-Hu-48T	DL Develop	48T	EUR 554
Should the Human Clock Homolog (CLOCK) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Clock Homolog (CLOCK) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Clock Homolog (CLOCK) ELISA Kit
DLR-CLOCK-Hu-96T	DL Develop	96T	EUR 725
Should the Human Clock Homolog (CLOCK) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Clock Homolog (CLOCK) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Peroxidasin Homolog (PXDN) ELISA Kit
DLR-PXDN-Hu-48T	DL Develop	48T	EUR 554
Should the Human Peroxidasin Homolog (PXDN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Peroxidasin Homolog (PXDN) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Peroxidasin Homolog (PXDN) ELISA Kit
DLR-PXDN-Hu-96T	DL Develop	96T	EUR 725
Should the Human Peroxidasin Homolog (PXDN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Peroxidasin Homolog (PXDN) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/micca.org/public_html/wp-content/plugins/gentaur-linking/vendor_prefixed/pwpf/src/View/View.php on line 66

Human MUTYH(MutY Homolog) ELISA Kit