Human NEUROD6(Neurogenic Differentiation 6) ELISA Kit

Notice: Trying to access array offset on value of type bool in /home/fwsoeulh/domains/micca.org/public_html/wp-content/plugins/gentaur-linking/app/Libs/LSPDRequest.php on line 194

Notice: Trying to access array offset on value of type bool in /home/fwsoeulh/domains/micca.org/public_html/wp-content/plugins/gentaur-linking/app/Libs/LSPDRequest.php on line 208

Notice: Trying to access array offset on value of type bool in /home/fwsoeulh/domains/micca.org/public_html/wp-content/plugins/gentaur-linking/app/Libs/LSPDRequest.php on line 229

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/micca.org/public_html/wp-content/plugins/gentaur-linking/vendor_prefixed/pwpf/src/View/View.php on line 103

Human NEUROD6(Neurogenic Differentiation 6) ELISA Kit

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/micca.org/public_html/wp-content/plugins/gentaur-linking/vendor_prefixed/pwpf/src/View/View.php on line 64

Human Neurogenic Differentiation 6 (NEUROD6) ELISA Kit
RD-NEUROD6-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Neurogenic Differentiation 6 (NEUROD6) ELISA Kit
RD-NEUROD6-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Neurogenic Differentiation 6 (NEUROD6)ELISA Kit
201-12-2924	SunredBio	96 tests	EUR 440
This Neurogenic Differentiation 6 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Neurogenic Differentiation 6 (NEUROD6) ELISA Kit
20-abx152491	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Neurogenic Differentiation 6(NEUROD6)ELISA Kit
QY-E01620	Qayee Biotechnology	96T	EUR 361

Human Neurogenic Differentiation 6 (NEUROD6) ELISA Kit
SEH552Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neurogenic Differentiation 6 (NEUROD6) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assa Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neurogenic Differentiation 6 (NEUROD6) in Tissue homogenates and other biological fluids.

Human Neurogenic Differentiation 6 (NEUROD6) ELISA Kit
SEH552Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neurogenic Differentiation 6 (NEUROD6) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assa Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neurogenic Differentiation 6 (NEUROD6) in Tissue homogenates and other biological fluids.

Human Neurogenic Differentiation 6 (NEUROD6) ELISA Kit
SEH552Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neurogenic Differentiation 6 (NEUROD6) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assa Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neurogenic Differentiation 6 (NEUROD6) in Tissue homogenates and other biological fluids.

Human Neurogenic Differentiation 6 (NEUROD6) ELISA Kit
SEH552Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neurogenic Differentiation 6 (NEUROD6) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assa Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neurogenic Differentiation 6 (NEUROD6) in Tissue homogenates and other biological fluids.

Human Neurogenic Differentiation 6 (NEUROD6) ELISA Kit
4-SEH552Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Neurogenic Differentiation 6 elisa. Alternative names of the recognized antigen: Atoh2 NEX1M Math-2 bHLHa2 Neurogenic differentiation factor 6 Mammalian Atonal Homolog 2 Atonal Homolog 2 Class A basic helix-loop-helix protein 2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Neurogenic Differentiation 6 (NEUROD6) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Neurogenic Differentiation 6 (NEUROD6) Antibody
abx027415-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Neurogenic Differentiation 6 (NEUROD6) Antibody
abx027415-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Neurogenic Differentiation 6 (NEUROD6) Antibody
20-abx132156	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Neurogenic Differentiation 6 (NEUROD6) Antibody
20-abx148406	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Neurogenic Differentiation 6 (NEUROD6) Antibody
20-abx173768	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Neurogenic Differentiation 6 (NEUROD6) Antibody
20-abx318053	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Human Neurogenic Differentiation 6 (NEUROD6) Protein
20-abx654510	Abbexa	EUR 648.00 EUR 272.00 EUR 1957.00 EUR 759.00 EUR 467.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Human Neurogenic Differentiation 6 (NEUROD6) CLIA Kit
20-abx495474	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Neurogenic differentiation factor 6, NEUROD6 ELISA KIT
ELI-20076h	Lifescience Market	96 Tests	EUR 824

ELISA kit for Human NEUROD6 (Neurogenic Differentiation 6)
ELK3348	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Neurogenic Differentiation 6 (NEUROD6). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specifi Show more
Description: A sandwich ELISA kit for detection of Neurogenic Differentiation 6 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Neurogenic Differentiation 6 (NEUROD6) Antibody (HRP)
20-abx316434	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Neurogenic Differentiation 6 (NEUROD6) Antibody (FITC)
20-abx316435	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Neurogenic Differentiation 6 (NEUROD6) Antibody (Biotin)
20-abx316436	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Mouse Neurogenic differentiation factor 6, Neurod6 ELISA KIT
ELI-13188m	Lifescience Market	96 Tests	EUR 865

Bovine Neurogenic differentiation factor 6, NEUROD6 ELISA KIT
ELI-46036b	Lifescience Market	96 Tests	EUR 928

Neurogenic Differentiation 6 (NEUROD6) Polyclonal Antibody (Human)
4-PAH552Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Inquire for antigen sequence. Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neurogenic Differentiation 6 (NEUROD6)

Neurogenic Differentiation 6 (NEUROD6) Polyclonal Antibody (Human), APC
4-PAH552Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Inquire for antigen sequence. Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neurogenic Differentiation 6 (NEUROD6). This antibody is labeled with APC.

Neurogenic Differentiation 6 (NEUROD6) Polyclonal Antibody (Human), Biotinylated
4-PAH552Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Inquire for antigen sequence. Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neurogenic Differentiation 6 (NEUROD6). This antibody is labeled with Biotin.

Neurogenic Differentiation 6 (NEUROD6) Polyclonal Antibody (Human), Cy3
4-PAH552Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Inquire for antigen sequence. Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neurogenic Differentiation 6 (NEUROD6). This antibody is labeled with Cy3.

Neurogenic Differentiation 6 (NEUROD6) Polyclonal Antibody (Human), FITC
4-PAH552Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Inquire for antigen sequence. Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neurogenic Differentiation 6 (NEUROD6). This antibody is labeled with FITC.

Neurogenic Differentiation 6 (NEUROD6) Polyclonal Antibody (Human), HRP
4-PAH552Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Inquire for antigen sequence. Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neurogenic Differentiation 6 (NEUROD6). This antibody is labeled with HRP.

Neurogenic Differentiation 6 (NEUROD6) Polyclonal Antibody (Human), PE
4-PAH552Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Inquire for antigen sequence. Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neurogenic Differentiation 6 (NEUROD6). This antibody is labeled with PE.

Neurogenic Differentiation 6 (NEUROD6) Polyclonal Antibody (Human), APC-Cy7
4-PAH552Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Inquire for antigen sequence. Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neurogenic Differentiation 6 (NEUROD6). This antibody is labeled with APC-Cy7.

Human Neurogenic Differentiation 1 (NEUROD1)ELISA Kit
201-12-2921	SunredBio	96 tests	EUR 440
This Neurogenic Differentiation 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Neurogenic Differentiation 2 (NEUROD2)ELISA Kit
201-12-2922	SunredBio	96 tests	EUR 440
This Neurogenic Differentiation 2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Neurogenic Differentiation 4 (NEUROD4)ELISA Kit
201-12-2923	SunredBio	96 tests	EUR 440
This Neurogenic Differentiation 4 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Neurogenic Differentiation 4(NEUROD4)ELISA Kit
QY-E01621	Qayee Biotechnology	96T	EUR 413

Human Neurogenic Differentiation 2(NEUROD2)ELISA Kit
QY-E01622	Qayee Biotechnology	96T	EUR 413

Human Neurogenic Differentiation 1(NEUROD1)ELISA Kit
QY-E01623	Qayee Biotechnology	96T	EUR 413

Human Neurogenic differentiation factor 1, NEUROD1 ELISA KIT
ELI-44083h	Lifescience Market	96 Tests	EUR 824

Human Neurogenic differentiation factor 2, NEUROD2 ELISA KIT
ELI-44693h	Lifescience Market	96 Tests	EUR 824

Human Neurogenic differentiation factor 4, NEUROD4 ELISA KIT
ELI-46035h	Lifescience Market	96 Tests	EUR 824

Neurogenic Differentiation Factor 2 (NEUROD2) ELISA Kit
abx595865-96tests	Abbexa	96 tests	EUR 637
Shipped within 1-2 weeks.

Recombinant human Neurogenic differentiation factor 4
P2216	FN Test	100ug	Ask for price
Uniprot ID: Q9HD90 Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Neurogenic differentiation factor 4

Mouse Neurogenic differentiation factor 1, Neurod1 ELISA KIT
ELI-23025m	Lifescience Market	96 Tests	EUR 865

Mouse Neurogenic differentiation factor 2, Neurod2 ELISA KIT
ELI-23026m	Lifescience Market	96 Tests	EUR 865

Mouse Neurogenic differentiation factor 4, Neurod4 ELISA KIT
ELI-23027m	Lifescience Market	96 Tests	EUR 865

NEUROD1 ELISA Kit| chicken Neurogenic differentiation factor 1
EF012424	Lifescience Market	96 Tests	EUR 689

Chicken Neurogenic differentiation factor 4, NEUROD4 ELISA KIT
ELI-44084c	Lifescience Market	96 Tests	EUR 928

Chicken Neurogenic differentiation factor 1, NEUROD1 ELISA KIT
ELI-44691c	Lifescience Market	96 Tests	EUR 928

Neurogenic Differentiation 1 (NEUROD1) Antibody
20-abx114072	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Neurod1 ELISA Kit| Rat Neurogenic differentiation factor 1 ELIS
EF019053	Lifescience Market	96 Tests	EUR 689

Neurod1 ELISA Kit| Mouse Neurogenic differentiation factor 1 EL
EF015664	Lifescience Market	96 Tests	EUR 689

NEUROD6 ELISA Kit (Human) (OKCD09064)
OKCD09064	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: NEUROD6 contains 1 basic helix-loop-helix (bHLH) domain. It activates E box-dependent transcription in collaboration with TCF3/E47 and may be a trans-acting factor involved in the development and maintenance of the mammalian nervous system. It transactivates the promoter of its own gene.NEUROD6 is a member of the NEUROD (NEUROD1; MIM 601724) family of basic helix-loop-helix (bHLH) transcription factors (Guo et al., 2002.)...;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.055ng/mL

NEUROD6 ELISA Kit (Human) (OKDD00423)
OKDD00423	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: This gene is a member of the NEUROD family of basic helix-loop-helix transcription factors. The encoded protein may be involved in the development and differentiation of the nervous system.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.055 ng/mL

Neurogenic Differentiation Factor 2 (NEUROD2) Antibody
abx011246-100ug	Abbexa	100 ug	EUR 439
Shipped within 5-10 working days.

Human Growth Differentiation Factor 6 ELISA kit
E01G0139-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Growth Differentiation Factor 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Growth Differentiation Factor 6 ELISA kit
E01G0139-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Growth Differentiation Factor 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Growth Differentiation Factor 6 ELISA kit
E01G0139-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Growth Differentiation Factor 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Individual Reaction Mix 6
G065-6	ABM	200 reactions	EUR 167

Human cluster of differentiation 6(CD6) ELISA kit
E01C1491-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human cluster of differentiation 6(CD6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human cluster of differentiation 6(CD6) ELISA kit
E01C1491-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human cluster of differentiation 6(CD6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human cluster of differentiation 6(CD6) ELISA kit
E01C1491-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human cluster of differentiation 6(CD6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Growth Differentiation Factor 6 (GDF6) ELISA Kit
20-abx151644	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Growth Differentiation Factor 6 (GDF6) ELISA Kit
abx252525-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human GDF6(Growth Differentiation Factor 6) ELISA Kit
EH3127	FN Test	96T	EUR 524.1
Detection range: 0.156-10 ng/ml Uniprot ID: Q6KF10 Alias: GDF6/BMP-13/BMP13/CDMP2/GDF16/GDF-6/growth differentiation factor 6/Growth/differentiation factor 16/growth/differentiation factor 6/KFS/KFS1/KFSL/MCOP4/MCOPCB6/MGC158100/MGC158101/SCDO4/SGM1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Growth/differentiation factor 6, GDF6 ELISA KIT
ELI-12531h	Lifescience Market	96 Tests	EUR 824

Human Growth/differentiation factor 6(GDF6) ELISA kit
CSB-EL009350HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Growth/differentiation factor 6 (GDF6) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Growth/differentiation factor 6(GDF6) ELISA kit
1-CSB-EL009350HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Growth/differentiation factor 6(GDF6) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human cluster of differentiation 6(CD6) ELISA Kit
CSB-E17494h-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human cluster of differentiation 6 (CD6) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human cluster of differentiation 6(CD6) ELISA Kit
1-CSB-E17494h	Cusabio	EUR 703.00 EUR 4843.00 EUR 2570.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human cluster of differentiation 6(CD6) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Cluster of Differentiation 6 (CD6) ELISA Kit
abx514435-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Growth Differentiation Factor 6 (GDF6) ELISA Kit
SEC111Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Growth Differentiation Factor 6 (GDF6) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assa Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Growth Differentiation Factor 6 (GDF6) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Growth Differentiation Factor 6 (GDF6) ELISA Kit
SEC111Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Growth Differentiation Factor 6 (GDF6) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assa Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Growth Differentiation Factor 6 (GDF6) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Growth Differentiation Factor 6 (GDF6) ELISA Kit
SEC111Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Growth Differentiation Factor 6 (GDF6) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assa Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Growth Differentiation Factor 6 (GDF6) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Growth Differentiation Factor 6 (GDF6) ELISA Kit
SEC111Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Growth Differentiation Factor 6 (GDF6) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assa Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Growth Differentiation Factor 6 (GDF6) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Growth Differentiation Factor 6 (GDF6) ELISA Kit
4-SEC111Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Growth Differentiation Factor 6 elisa. Alternative names of the recognized antigen: BMP13 CDMP2 GDF16 Bone morphogenetic protein 13 Growth/differentiation factor 16
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Growth Differentiation Factor 6 (GDF6) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Random Nanofibers 6 Well Plate
3D00006-6	Neuromics	700 nm-PCLs	EUR 93

Aligned Nanofibers 6 Well Plate
3D00012-6	Neuromics	700 nm-PCLs	EUR 97

pLenti-CLDN1 shRNA-6 Plasmid
PVTBAV04867-6	Lifescience Market	2 ug	EUR 356

Mouse IL-6 Recombinant Protein
R00102-6	BosterBio	5ug/vial	EUR 259
Description: Interleukin-6 (IL-6) is an interleukin that acts as both a pro-inflammatory and anti-inflammatory cytokine. Mouse IL-6 Recombinant Protein is purified interleukin-6 produced in yeast.

Tissue Culture Plate, 6 Well
TCP20-6	Bio Basic	1 UNIT	EUR 53.48
Product category: Labware/Culture Related/Culture Plates - Multiwell

NEUROD6 Antibody
44673-100ul	SAB	100ul	EUR 252

NEUROD6 Antibody
44673-50ul	SAB	50ul	EUR 187

NEUROD6 Antibody
1-CSB-PA846677LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NEUROD6. Recognizes NEUROD6 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000

NEUROD6 Antibody
DF2216	Affbiotech	200ul	EUR 304
Description: NEUROD6 antibody detects endogenous levels of total NEUROD6.

NEUROD6 siRNA
20-abx925778	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NEUROD6 siRNA
20-abx925779	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NEUROD6 Antibody
ABD2216	Lifescience Market	100 ug	EUR 438

ExoStd? Lyophilized Exosome Standard (30 µg, Human Plasma, 6 vials)
M1040-6	Biovision		EUR 1300

ExoStd? Lyophilized Exosome Standard (100 µg, Human Plasma, 6 vials)
M1041-6	Biovision		EUR 1572

ExoStd? Lyophilized Exosome Standard (30 µg, Human Serum, 6 vials)
M1042-6	Biovision		EUR 1300

ExoStd? Lyophilized Exosome Standard (100 µg, Human Serum, 6 vials)
M1043-6	Biovision		EUR 1572

ExoStd? Lyophilized Exosome Standard (30 µg, Human Urine, 6 vials)
M1044-6	Biovision		EUR 1289

ExoStd? Lyophilized Exosome Standard (100 µg, Human Urine, 6 vials)
M1045-6	Biovision		EUR 1572

ExoStd? Lyophilized Exosome Standard (30 µg, Human Saliva, 6 vials)
M1046-6	Biovision		EUR 1306

ExoStd? Lyophilized Exosome Standard (100 µg, Human Saliva, 6 vials)
M1047-6	Biovision		EUR 1621

Rat Growth Differentiation Factor 6 ELISA kit
E02G0139-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Growth Differentiation Factor 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Growth Differentiation Factor 6 ELISA kit
E02G0139-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Growth Differentiation Factor 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Growth Differentiation Factor 6 ELISA kit
E02G0139-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Growth Differentiation Factor 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Growth Differentiation Factor 6 ELISA kit
E03G0139-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Growth Differentiation Factor 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Growth Differentiation Factor 6 ELISA kit
E03G0139-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Growth Differentiation Factor 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Growth Differentiation Factor 6 ELISA kit
E03G0139-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Growth Differentiation Factor 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Growth Differentiation Factor 6 ELISA kit
E04G0139-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Growth Differentiation Factor 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Growth Differentiation Factor 6 ELISA kit
E04G0139-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Growth Differentiation Factor 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Growth Differentiation Factor 6 ELISA kit
E04G0139-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Growth Differentiation Factor 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Growth Differentiation Factor 6 ELISA kit
E06G0139-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Growth Differentiation Factor 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Growth Differentiation Factor 6 ELISA kit
E06G0139-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Growth Differentiation Factor 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Growth Differentiation Factor 6 ELISA kit
E06G0139-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Growth Differentiation Factor 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Growth Differentiation Factor 6 ELISA kit
E09G0139-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Growth Differentiation Factor 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Growth Differentiation Factor 6 ELISA kit
E09G0139-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Growth Differentiation Factor 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Growth Differentiation Factor 6 ELISA kit
E09G0139-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Growth Differentiation Factor 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Growth Differentiation Factor 6 ELISA kit
E08G0139-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Growth Differentiation Factor 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Growth Differentiation Factor 6 ELISA kit
E08G0139-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Growth Differentiation Factor 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Growth Differentiation Factor 6 ELISA kit
E08G0139-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Growth Differentiation Factor 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Growth Differentiation Factor 6 ELISA kit
E07G0139-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Growth Differentiation Factor 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Growth Differentiation Factor 6 ELISA kit
E07G0139-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Growth Differentiation Factor 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Growth Differentiation Factor 6 ELISA kit
E07G0139-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Growth Differentiation Factor 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Aligned Nanofibers 6 Well Plate Inserts
3D00016-6	Neuromics	700 nm-PCLs	EUR 98

ELISA kit for Human GDF6 (Growth Differentiation Factor 6)
E-EL-H1912	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's GDF6 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human GDF6. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Human GDF6 (Growth Differentiation Factor 6) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human GDF6 (Growth Differentiation Factor 6)
ELK4974	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Growth Differentiation Factor 6 (GDF6). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specifi Show more
Description: A sandwich ELISA kit for detection of Growth Differentiation Factor 6 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human NEUROD6 shRNA Plasmid
20-abx961886	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

NEUROD6 Recombinant Protein (Human)
RP021097	ABM	100 ug	Ask for price

AFP (Alpha fetoprotein) ELISA test
6	Biobase	96T/Box	Ask for price
Area of application: Hormone testing
Description: ELISA based test for quantitative detection of AFP (Alpha fetoprotein)

Rat cluster of differentiation 6(CD6) ELISA kit
E02C1491-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat cluster of differentiation 6(CD6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat cluster of differentiation 6(CD6) ELISA kit
E02C1491-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat cluster of differentiation 6(CD6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat cluster of differentiation 6(CD6) ELISA kit
E02C1491-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat cluster of differentiation 6(CD6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Growth Differentiation Factor 6 ELISA kit
E05G0139-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Growth Differentiation Factor 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Growth Differentiation Factor 6 ELISA kit
E05G0139-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Growth Differentiation Factor 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Growth Differentiation Factor 6 ELISA kit
E05G0139-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Growth Differentiation Factor 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat cluster of differentiation 6(CD6) ELISA kit
E06C1491-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat cluster of differentiation 6(CD6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat cluster of differentiation 6(CD6) ELISA kit
E06C1491-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat cluster of differentiation 6(CD6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat cluster of differentiation 6(CD6) ELISA kit
E06C1491-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat cluster of differentiation 6(CD6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit cluster of differentiation 6(CD6) ELISA kit
E04C1491-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit cluster of differentiation 6(CD6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit cluster of differentiation 6(CD6) ELISA kit
E04C1491-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit cluster of differentiation 6(CD6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit cluster of differentiation 6(CD6) ELISA kit
E04C1491-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit cluster of differentiation 6(CD6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse cluster of differentiation 6(CD6) ELISA kit
E03C1491-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse cluster of differentiation 6(CD6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse cluster of differentiation 6(CD6) ELISA kit
E03C1491-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse cluster of differentiation 6(CD6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse cluster of differentiation 6(CD6) ELISA kit
E03C1491-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse cluster of differentiation 6(CD6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig cluster of differentiation 6(CD6) ELISA kit
E07C1491-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine cluster of differentiation 6(CD6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig cluster of differentiation 6(CD6) ELISA kit
E07C1491-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine cluster of differentiation 6(CD6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig cluster of differentiation 6(CD6) ELISA kit
E07C1491-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine cluster of differentiation 6(CD6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Growth Differentiation Factor 6 (GDF6) ELISA Kit
abx254118-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Rat Growth Differentiation Factor 6 (GDF6) ELISA Kit
abx256955-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Monkey cluster of differentiation 6(CD6) ELISA kit
E09C1491-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey cluster of differentiation 6(CD6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey cluster of differentiation 6(CD6) ELISA kit
E09C1491-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey cluster of differentiation 6(CD6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey cluster of differentiation 6(CD6) ELISA kit
E09C1491-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey cluster of differentiation 6(CD6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog cluster of differentiation 6(CD6) ELISA kit
E08C1491-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine cluster of differentiation 6(CD6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog cluster of differentiation 6(CD6) ELISA kit
E08C1491-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine cluster of differentiation 6(CD6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog cluster of differentiation 6(CD6) ELISA kit
E08C1491-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine cluster of differentiation 6(CD6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Growth/differentiation factor 6, Gdf6 ELISA KIT
ELI-31265m	Lifescience Market	96 Tests	EUR 865

Bovine Growth/differentiation factor 6, GDF6 ELISA KIT
ELI-26549b	Lifescience Market	96 Tests	EUR 928

Canine cluster of differentiation 6,CD6 ELISA Kit
CN-00926C1	ChemNorm	96T	EUR 471

Canine cluster of differentiation 6,CD6 ELISA Kit
CN-00926C2	ChemNorm	48T	EUR 322

Mouse cluster of differentiation 6(CD6) ELISA Kit
CSB-EL004949MO-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitative sandwich ELISA kit for measuring Mouse cluster of differentiation 6 (CD6) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse cluster of differentiation 6(CD6) ELISA Kit
1-CSB-EL004949MO	Cusabio	EUR 703.00 EUR 4843.00 EUR 2570.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitative sandwich ELISA kit for measuring Mouse cluster of differentiation 6(CD6) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Pig Growth Differentiation Factor 6 (GDF6) ELISA Kit
abx360522-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rabbit Growth Differentiation Factor 6 (GDF6) ELISA Kit
abx363095-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rat Cluster of Differentiation 6 (CD6) ELISA Kit
abx353582-96tests	Abbexa	96 tests	EUR 786
Shipped within 5-12 working days.

Chicken Growth Differentiation Factor 6 (GDF6) ELISA Kit
abx356607-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Monkey Growth Differentiation Factor 6 (GDF6) ELISA Kit
abx358914-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Mouse Cluster of Differentiation 6 (CD6) ELISA Kit
abx514436-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Mouse GDF6(Growth Differentiation Factor 6) ELISA Kit
EM1067	FN Test	96T	EUR 524.1
Detection range: 0.313-20 ng/ml Uniprot ID: P43028 Alias: GDF6/BMP-13/BMP13/CDMP2/GDF16/GDF-6/growth differentiation factor 6/Growth/differentiation factor 16/growth/differentiation factor 6/KFS/KFS1/KFSL/MCOP4/MCOPCB6/MGC158100/MGC158101/SCDO4/SGM1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.188 ng/ml

Rat GDF6(Growth Differentiation Factor 6) ELISA Kit
ER0989	FN Test	96T	EUR 524.1
Detection range: 1.563-100 ng/ml Uniprot ID: Q6HA10 Alias: GDF6/BMP-13/BMP13/CDMP2/GDF16/GDF-6/growth differentiation factor 6/Growth/differentiation factor 16/growth/differentiation factor 6/KFS/KFS1/KFSL/MCOP4/MCOPCB6/MGC158100/MGC158101/SCDO4/SGM1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.938 ng/ml

Canine Cluster Of Differentiation 6(CD6)ELISA Kit
GA-E0055CN-48T	GenAsia Biotech	48T	EUR 402

Canine Cluster Of Differentiation 6(CD6)ELISA Kit
GA-E0055CN-96T	GenAsia Biotech	96T	EUR 684

Canine cluster of differentiation 6,CD6 ELISA Kit
QY-E70061	Qayee Biotechnology	96T	EUR 426

GDF6 ELISA Kit| Rat Growth Differentiation Factor 6 ELISA Kit
EF017761	Lifescience Market	96 Tests	EUR 689

GDF6 ELISA Kit| Mouse Growth Differentiation Factor 6 ELISA Kit
EF013635	Lifescience Market	96 Tests	EUR 689

NEUROD6 Rabbit pAb
A15881-100ul	Abclonal	100 ul	EUR 308

NEUROD6 Rabbit pAb
A15881-200ul	Abclonal	200 ul	EUR 459

NEUROD6 Rabbit pAb
A15881-20ul	Abclonal	20 ul	EUR 183

NEUROD6 Rabbit pAb
A15881-50ul	Abclonal	50 ul	EUR 223

NEUROD6 Blocking Peptide
DF2216-BP	Affbiotech	1mg	EUR 195

NEUROD6 Conjugated Antibody
C44673	SAB	100ul	EUR 397

NEUROD6 cloning plasmid
CSB-CL846677HU-10ug	Cusabio	10ug	EUR 394
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1014 Sequence: atgttaacactaccgtttgatgagtctgttgtaatgccagaatcccagatgtgcagaaagttttctagagaatgcgaggaccagaagcaaattaagaagccagaaagcttttccaaacagattgtccttcgaggaaagagcatcaaaagggcccctggagaagaaaccgagaaag Show more
Description: A cloning plasmid for the NEUROD6 gene.

Anti-NEUROD6 antibody
STJ118340	St John's Laboratory	100 µl	EUR 277

Anti-NEUROD6 (4G11)
YF-MA20575	Abfrontier	200 ul	EUR 363
Description: Mouse monoclonal to NEUROD6

Anti-NEUROD6 (1B5)
YF-MA20576	Abfrontier	200 ul	EUR 363
Description: Mouse monoclonal to NEUROD6

ExoStd? Lyophilized Exosome Standard (30 µg, U87 MG, 6 vials)
M1054-6	Biovision		EUR 1306

ExoStd? Lyophilized Exosome Standard (100 µg, U87 MG, 6 vials)
M1055-6	Biovision		EUR 1616

Human Growth Differentiation Factor 6 (GDF6) CLIA Kit
20-abx493468	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Recombinant human Growth/differentiation factor 6
P1871	FN Test	100ug	Ask for price
Uniprot ID: Q6KF10 Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Growth/differentiation factor 6

ExoStd? Lyophilized Exosome Standard (30 µg, COLO1 cell line, 6 vials)
M1048-6	Biovision		EUR 1306

ExoStd? Lyophilized Exosome Standard (100 µg, COLO1 cell line, 6 vials)
M1049-6	Biovision		EUR 1616

ExoStd? Lyophilized Exosome Standard (30 µg, MM1 cell line, 6 vials)
M1050-6	Biovision		EUR 1306

ExoStd? Lyophilized Exosome Standard (100 µg, MM1 cell line, 6 vials)
M1051-6	Biovision		EUR 1616

ExoStd? Lyophilized Exosome Standard (30 µg, BLCL21 cell line, 6 vials)
M1052-6	Biovision		EUR 1306

ExoStd? Lyophilized Exosome Standard (100 µg, BLCL21 cell line, 6 vials)
M1053-6	Biovision		EUR 1572

ExoStd? Lyophilized Exosome Standard (30 µg, HCT116 cell line, 6 vials)
M1058-6	Biovision		EUR 1306

ExoStd? Lyophilized Exosome Standard (100 µg, HCT116 cell line, 6 vials)
M1059-6	Biovision		EUR 1616

ExoStd? Lyophilized Exosome Standard (30 µg, PC3 cell line, 6 vials)
M1060-6	Biovision		EUR 1306

ExoStd? Lyophilized Exosome Standard (100 µg, PC3 cell line, 6 vials)
M1061-6	Biovision		EUR 1616

ExoStd? Lyophilized Exosome Standard (30 µg, DAUD1 cell line, 6 vials)
M1064-6	Biovision		EUR 1306

ExoStd? Lyophilized Exosome Standard (100 µg, DAUD1 cell line, 6 vials)
M1065-6	Biovision		EUR 1616

ExoStd? Lyophilized Exosome Standard (30 µg, A549 cell line, 6 vials)
M1066-6	Biovision		EUR 1306

ExoStd? Lyophilized Exosome Standard (100 µg, A549 cell line, 6 vials)
M1067-6	Biovision		EUR 1616

ExoStd? Lyophilized Exosome Standard (30 µg, B16F10 cell line, 6 vials)
M1070-6	Biovision		EUR 1306

ExoStd? Lyophilized Exosome Standard (1090 µg, B16F10 cell line, 6 vials)
M1071-6	Biovision		EUR 1616

NEUROD6 ORF Vector (Human) (pORF)
ORF007033	ABM	1.0 ug DNA	EUR 95

ExoStd? Lyophilized Exosome Standard (30 µg, BPH-1 cell line, 6 vials)
M1062-6	Biovision		EUR 1306

ExoStd? Lyophilized Exosome Standard (100 µg, BPH-1 cell line, 6 vials)
M1063-6	Biovision		EUR 1616

ExoStd? Lyophilized Exosome Standard (30 µg, K-562 cell line, 6 vials)
M1068-6	Biovision		EUR 1306

ExoStd? Lyophilized Exosome Standard (100 µg, K-562 cell line, 6 vials)
M1069-6	Biovision		EUR 1616

ELISA kit for Mouse GDF6 (Growth Differentiation Factor 6)
E-EL-M1271	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's GDF6 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse GDF6. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse GDF6 (Growth Differentiation Factor 6) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Rat CD6 (Cluster of Differentiation 6)
E-EL-R0218	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's CD6 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat CD6. Standards or samples are added to the micro ELISA plate wells and combined with the sp Show more
Description: A sandwich ELISA kit for quantitative measurement of Rat CD6 (Cluster of Differentiation 6) in samples from Serum, Plasma, Cell supernatant

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/micca.org/public_html/wp-content/plugins/gentaur-linking/vendor_prefixed/pwpf/src/View/View.php on line 66

Human NEUROD6(Neurogenic Differentiation 6) ELISA Kit