Human NEUROD6(Neurogenic Differentiation 6) ELISA Kit
Human Neurogenic Differentiation 6 (NEUROD6) ELISA Kit |
RD-NEUROD6-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Neurogenic Differentiation 6 (NEUROD6) ELISA Kit |
RD-NEUROD6-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Neurogenic Differentiation 6 (NEUROD6)ELISA Kit |
201-12-2924 |
SunredBio |
96 tests |
EUR 440 |
- This Neurogenic Differentiation 6 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Neurogenic Differentiation 6 (NEUROD6) ELISA Kit |
20-abx152491 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Neurogenic Differentiation 6 (NEUROD6) ELISA Kit |
SEH552Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neurogenic Differentiation 6 (NEUROD6) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assa
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neurogenic Differentiation 6 (NEUROD6) in Tissue homogenates and other biological fluids. |
Human Neurogenic Differentiation 6 (NEUROD6) ELISA Kit |
SEH552Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neurogenic Differentiation 6 (NEUROD6) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assa
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neurogenic Differentiation 6 (NEUROD6) in Tissue homogenates and other biological fluids. |
Human Neurogenic Differentiation 6 (NEUROD6) ELISA Kit |
SEH552Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neurogenic Differentiation 6 (NEUROD6) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assa
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neurogenic Differentiation 6 (NEUROD6) in Tissue homogenates and other biological fluids. |
Human Neurogenic Differentiation 6 (NEUROD6) ELISA Kit |
SEH552Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neurogenic Differentiation 6 (NEUROD6) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assa
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neurogenic Differentiation 6 (NEUROD6) in Tissue homogenates and other biological fluids. |
Human Neurogenic Differentiation 6 (NEUROD6) ELISA Kit |
4-SEH552Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Neurogenic Differentiation 6 elisa. Alternative names of the recognized antigen: Atoh2
- NEX1M
- Math-2
- bHLHa2
- Neurogenic differentiation factor 6
- Mammalian Atonal Homolog 2
- Atonal Homolog 2
- Class A basic helix-loop-helix protein 2
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Neurogenic Differentiation 6 (NEUROD6) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Neurogenic Differentiation 6 (NEUROD6) Antibody |
abx027415-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Neurogenic Differentiation 6 (NEUROD6) Antibody |
abx027415-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Neurogenic Differentiation 6 (NEUROD6) Antibody |
20-abx132156 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Neurogenic Differentiation 6 (NEUROD6) Antibody |
20-abx148406 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Neurogenic Differentiation 6 (NEUROD6) Antibody |
20-abx173768 |
Abbexa |
|
|
|
Neurogenic Differentiation 6 (NEUROD6) Antibody |
20-abx318053 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Human Neurogenic Differentiation 6 (NEUROD6) Protein |
20-abx654510 |
Abbexa |
-
EUR 648.00
-
EUR 272.00
-
EUR 1957.00
-
EUR 759.00
-
EUR 467.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Human Neurogenic Differentiation 6 (NEUROD6) CLIA Kit |
20-abx495474 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Human Neurogenic differentiation factor 6, NEUROD6 ELISA KIT |
ELI-20076h |
Lifescience Market |
96 Tests |
EUR 824 |
ELISA kit for Human NEUROD6 (Neurogenic Differentiation 6) |
ELK3348 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Neurogenic Differentiation 6 (NEUROD6). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specifi
- Show more
|
Description: A sandwich ELISA kit for detection of Neurogenic Differentiation 6 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Neurogenic Differentiation 6 (NEUROD6) Antibody (HRP) |
20-abx316434 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Neurogenic Differentiation 6 (NEUROD6) Antibody (FITC) |
20-abx316435 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Neurogenic Differentiation 6 (NEUROD6) Antibody (Biotin) |
20-abx316436 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Mouse Neurogenic differentiation factor 6, Neurod6 ELISA KIT |
ELI-13188m |
Lifescience Market |
96 Tests |
EUR 865 |
Bovine Neurogenic differentiation factor 6, NEUROD6 ELISA KIT |
ELI-46036b |
Lifescience Market |
96 Tests |
EUR 928 |
Neurogenic Differentiation 6 (NEUROD6) Polyclonal Antibody (Human) |
4-PAH552Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Neurogenic Differentiation 6 (NEUROD6) |
Neurogenic Differentiation 6 (NEUROD6) Polyclonal Antibody (Human), APC |
4-PAH552Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Neurogenic Differentiation 6 (NEUROD6). This antibody is labeled with APC. |
Neurogenic Differentiation 6 (NEUROD6) Polyclonal Antibody (Human), Biotinylated |
4-PAH552Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Neurogenic Differentiation 6 (NEUROD6). This antibody is labeled with Biotin. |
Neurogenic Differentiation 6 (NEUROD6) Polyclonal Antibody (Human), Cy3 |
4-PAH552Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Neurogenic Differentiation 6 (NEUROD6). This antibody is labeled with Cy3. |
Neurogenic Differentiation 6 (NEUROD6) Polyclonal Antibody (Human), FITC |
4-PAH552Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Neurogenic Differentiation 6 (NEUROD6). This antibody is labeled with FITC. |
Neurogenic Differentiation 6 (NEUROD6) Polyclonal Antibody (Human), HRP |
4-PAH552Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Neurogenic Differentiation 6 (NEUROD6). This antibody is labeled with HRP. |
Neurogenic Differentiation 6 (NEUROD6) Polyclonal Antibody (Human), PE |
4-PAH552Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Neurogenic Differentiation 6 (NEUROD6). This antibody is labeled with PE. |
Neurogenic Differentiation 6 (NEUROD6) Polyclonal Antibody (Human), APC-Cy7 |
4-PAH552Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Neurogenic Differentiation 6 (NEUROD6). This antibody is labeled with APC-Cy7. |
Human Neurogenic Differentiation 1 (NEUROD1)ELISA Kit |
201-12-2921 |
SunredBio |
96 tests |
EUR 440 |
- This Neurogenic Differentiation 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Neurogenic Differentiation 2 (NEUROD2)ELISA Kit |
201-12-2922 |
SunredBio |
96 tests |
EUR 440 |
- This Neurogenic Differentiation 2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Neurogenic Differentiation 4 (NEUROD4)ELISA Kit |
201-12-2923 |
SunredBio |
96 tests |
EUR 440 |
- This Neurogenic Differentiation 4 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Neurogenic differentiation factor 1, NEUROD1 ELISA KIT |
ELI-44083h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Neurogenic differentiation factor 2, NEUROD2 ELISA KIT |
ELI-44693h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Neurogenic differentiation factor 4, NEUROD4 ELISA KIT |
ELI-46035h |
Lifescience Market |
96 Tests |
EUR 824 |
Neurogenic Differentiation Factor 2 (NEUROD2) ELISA Kit |
abx595865-96tests |
Abbexa |
96 tests |
EUR 637 |
- Shipped within 1-2 weeks.
|
Recombinant human Neurogenic differentiation factor 4 |
P2216 |
FN Test |
100ug |
Ask for price |
- Uniprot ID: Q9HD90
- Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
|
Description: Recombinant protein for human Neurogenic differentiation factor 4 |
Mouse Neurogenic differentiation factor 1, Neurod1 ELISA KIT |
ELI-23025m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Neurogenic differentiation factor 2, Neurod2 ELISA KIT |
ELI-23026m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Neurogenic differentiation factor 4, Neurod4 ELISA KIT |
ELI-23027m |
Lifescience Market |
96 Tests |
EUR 865 |
NEUROD1 ELISA Kit| chicken Neurogenic differentiation factor 1 |
EF012424 |
Lifescience Market |
96 Tests |
EUR 689 |
Chicken Neurogenic differentiation factor 4, NEUROD4 ELISA KIT |
ELI-44084c |
Lifescience Market |
96 Tests |
EUR 928 |
Chicken Neurogenic differentiation factor 1, NEUROD1 ELISA KIT |
ELI-44691c |
Lifescience Market |
96 Tests |
EUR 928 |
Neurogenic Differentiation 1 (NEUROD1) Antibody |
20-abx114072 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Neurod1 ELISA Kit| Rat Neurogenic differentiation factor 1 ELIS |
EF019053 |
Lifescience Market |
96 Tests |
EUR 689 |
Neurod1 ELISA Kit| Mouse Neurogenic differentiation factor 1 EL |
EF015664 |
Lifescience Market |
96 Tests |
EUR 689 |
Neurogenic Differentiation Factor 2 (NEUROD2) Antibody |
abx011246-100ug |
Abbexa |
100 ug |
EUR 439 |
- Shipped within 5-10 working days.
|
Human Growth Differentiation Factor 6 ELISA kit |
E01G0139-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Growth Differentiation Factor 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Growth Differentiation Factor 6 ELISA kit |
E01G0139-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Growth Differentiation Factor 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Growth Differentiation Factor 6 ELISA kit |
E01G0139-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Growth Differentiation Factor 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Individual Reaction Mix 6 |
G065-6 |
ABM |
200 reactions |
EUR 167 |
Human cluster of differentiation 6(CD6) ELISA kit |
E01C1491-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human cluster of differentiation 6(CD6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human cluster of differentiation 6(CD6) ELISA kit |
E01C1491-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human cluster of differentiation 6(CD6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human cluster of differentiation 6(CD6) ELISA kit |
E01C1491-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human cluster of differentiation 6(CD6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Growth Differentiation Factor 6 (GDF6) ELISA Kit |
20-abx151644 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Growth Differentiation Factor 6 (GDF6) ELISA Kit |
abx252525-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Human GDF6(Growth Differentiation Factor 6) ELISA Kit |
EH3127 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: Q6KF10
- Alias: GDF6/BMP-13/BMP13/CDMP2/GDF16/GDF-6/growth differentiation factor 6/Growth/differentiation factor 16/growth/differentiation factor 6/KFS/KFS1/KFSL/MCOP4/MCOPCB6/MGC158100/MGC158101/SCDO4/SGM1
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
Human Growth/differentiation factor 6, GDF6 ELISA KIT |
ELI-12531h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Growth/differentiation factor 6(GDF6) ELISA kit |
CSB-EL009350HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Growth/differentiation factor 6 (GDF6) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Growth/differentiation factor 6(GDF6) ELISA kit |
1-CSB-EL009350HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Growth/differentiation factor 6(GDF6) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human cluster of differentiation 6(CD6) ELISA Kit |
CSB-E17494h-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human cluster of differentiation 6 (CD6) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human cluster of differentiation 6(CD6) ELISA Kit |
1-CSB-E17494h |
Cusabio |
-
EUR 703.00
-
EUR 4843.00
-
EUR 2570.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human cluster of differentiation 6(CD6) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human Cluster of Differentiation 6 (CD6) ELISA Kit |
abx514435-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Growth Differentiation Factor 6 (GDF6) ELISA Kit |
SEC111Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Growth Differentiation Factor 6 (GDF6) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assa
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Growth Differentiation Factor 6 (GDF6) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Growth Differentiation Factor 6 (GDF6) ELISA Kit |
SEC111Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Growth Differentiation Factor 6 (GDF6) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assa
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Growth Differentiation Factor 6 (GDF6) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Growth Differentiation Factor 6 (GDF6) ELISA Kit |
SEC111Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Growth Differentiation Factor 6 (GDF6) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assa
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Growth Differentiation Factor 6 (GDF6) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Growth Differentiation Factor 6 (GDF6) ELISA Kit |
SEC111Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Growth Differentiation Factor 6 (GDF6) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assa
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Growth Differentiation Factor 6 (GDF6) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Growth Differentiation Factor 6 (GDF6) ELISA Kit |
4-SEC111Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Growth Differentiation Factor 6 elisa. Alternative names of the recognized antigen: BMP13
- CDMP2
- GDF16
- Bone morphogenetic protein 13
- Growth/differentiation factor 16
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Growth Differentiation Factor 6 (GDF6) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Random Nanofibers 6 Well Plate |
3D00006-6 |
Neuromics |
700 nm-PCLs |
EUR 93 |
Aligned Nanofibers 6 Well Plate |
3D00012-6 |
Neuromics |
700 nm-PCLs |
EUR 97 |
Mouse IL-6 Recombinant Protein |
R00102-6 |
BosterBio |
5ug/vial |
EUR 259 |
Description: Interleukin-6 (IL-6) is an interleukin that acts as both a pro-inflammatory and anti-inflammatory cytokine. Mouse IL-6 Recombinant Protein is purified interleukin-6 produced in yeast. |
Tissue Culture Plate, 6 Well |
TCP20-6 |
BBI Biotech |
1 UNIT |
EUR 53.48 |
- Product category: Labware/Culture Related/Culture Plates - Multiwell
|
NEUROD6 Antibody |
44673-100ul |
SAB |
100ul |
EUR 252 |
NEUROD6 Antibody |
44673-50ul |
SAB |
50ul |
EUR 187 |
NEUROD6 Antibody |
1-CSB-PA846677LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NEUROD6. Recognizes NEUROD6 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000 |
NEUROD6 Antibody |
DF2216 |
Affbiotech |
200ul |
EUR 304 |
Description: NEUROD6 antibody detects endogenous levels of total NEUROD6. |
NEUROD6 siRNA |
20-abx925778 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NEUROD6 siRNA |
20-abx925779 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Rat Growth Differentiation Factor 6 ELISA kit |
E02G0139-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Growth Differentiation Factor 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Growth Differentiation Factor 6 ELISA kit |
E02G0139-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Growth Differentiation Factor 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Growth Differentiation Factor 6 ELISA kit |
E02G0139-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Growth Differentiation Factor 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Growth Differentiation Factor 6 ELISA kit |
E03G0139-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Growth Differentiation Factor 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Growth Differentiation Factor 6 ELISA kit |
E03G0139-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Growth Differentiation Factor 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Growth Differentiation Factor 6 ELISA kit |
E03G0139-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Growth Differentiation Factor 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Growth Differentiation Factor 6 ELISA kit |
E04G0139-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Growth Differentiation Factor 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Growth Differentiation Factor 6 ELISA kit |
E04G0139-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Growth Differentiation Factor 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Growth Differentiation Factor 6 ELISA kit |
E04G0139-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Growth Differentiation Factor 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Growth Differentiation Factor 6 ELISA kit |
E06G0139-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Growth Differentiation Factor 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Growth Differentiation Factor 6 ELISA kit |
E06G0139-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Growth Differentiation Factor 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Growth Differentiation Factor 6 ELISA kit |
E06G0139-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Growth Differentiation Factor 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Growth Differentiation Factor 6 ELISA kit |
E09G0139-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Growth Differentiation Factor 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Growth Differentiation Factor 6 ELISA kit |
E09G0139-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Growth Differentiation Factor 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Growth Differentiation Factor 6 ELISA kit |
E09G0139-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Growth Differentiation Factor 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Growth Differentiation Factor 6 ELISA kit |
E08G0139-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Growth Differentiation Factor 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Growth Differentiation Factor 6 ELISA kit |
E08G0139-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Growth Differentiation Factor 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Growth Differentiation Factor 6 ELISA kit |
E08G0139-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Growth Differentiation Factor 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Growth Differentiation Factor 6 ELISA kit |
E07G0139-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Growth Differentiation Factor 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Growth Differentiation Factor 6 ELISA kit |
E07G0139-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Growth Differentiation Factor 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Growth Differentiation Factor 6 ELISA kit |
E07G0139-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Growth Differentiation Factor 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
ExoStd? Lyophilized Exosome Standard (30 µg, Human Plasma, 6 vials) |
M1040-6 |
Biovision |
|
EUR 1300 |
ExoStd? Lyophilized Exosome Standard (100 µg, Human Plasma, 6 vials) |
M1041-6 |
Biovision |
|
EUR 1572 |
ExoStd? Lyophilized Exosome Standard (30 µg, Human Serum, 6 vials) |
M1042-6 |
Biovision |
|
EUR 1300 |
ExoStd? Lyophilized Exosome Standard (100 µg, Human Serum, 6 vials) |
M1043-6 |
Biovision |
|
EUR 1572 |
ExoStd? Lyophilized Exosome Standard (30 µg, Human Urine, 6 vials) |
M1044-6 |
Biovision |
|
EUR 1289 |
ExoStd? Lyophilized Exosome Standard (100 µg, Human Urine, 6 vials) |
M1045-6 |
Biovision |
|
EUR 1572 |
ExoStd? Lyophilized Exosome Standard (30 µg, Human Saliva, 6 vials) |
M1046-6 |
Biovision |
|
EUR 1306 |
ExoStd? Lyophilized Exosome Standard (100 µg, Human Saliva, 6 vials) |
M1047-6 |
Biovision |
|
EUR 1621 |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
Aligned Nanofibers 6 Well Plate Inserts |
3D00016-6 |
Neuromics |
700 nm-PCLs |
EUR 98 |
ELISA kit for Human GDF6 (Growth Differentiation Factor 6) |
E-EL-H1912 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's GDF6 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human GDF6. Standards or samples are added to the micro ELISA plate wells and combined with th
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Human GDF6 (Growth Differentiation Factor 6) in samples from Serum, Plasma, Cell supernatant |
ELISA kit for Human GDF6 (Growth Differentiation Factor 6) |
ELK4974 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Growth Differentiation Factor 6 (GDF6). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specifi
- Show more
|
Description: A sandwich ELISA kit for detection of Growth Differentiation Factor 6 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Human NEUROD6 shRNA Plasmid |
20-abx961886 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
NEUROD6 Recombinant Protein (Human) |
RP021097 |
ABM |
100 ug |
Ask for price |
AFP (Alpha fetoprotein) ELISA test |
6 |
Biobase |
96T/Box |
Ask for price |
- Area of application: Hormone testing
|
Description: ELISA based test for quantitative detection of AFP (Alpha fetoprotein) |
Rat cluster of differentiation 6(CD6) ELISA kit |
E02C1491-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat cluster of differentiation 6(CD6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat cluster of differentiation 6(CD6) ELISA kit |
E02C1491-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat cluster of differentiation 6(CD6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat cluster of differentiation 6(CD6) ELISA kit |
E02C1491-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat cluster of differentiation 6(CD6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Growth Differentiation Factor 6 ELISA kit |
E05G0139-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Growth Differentiation Factor 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Growth Differentiation Factor 6 ELISA kit |
E05G0139-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Growth Differentiation Factor 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Growth Differentiation Factor 6 ELISA kit |
E05G0139-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Growth Differentiation Factor 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat cluster of differentiation 6(CD6) ELISA kit |
E06C1491-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat cluster of differentiation 6(CD6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat cluster of differentiation 6(CD6) ELISA kit |
E06C1491-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat cluster of differentiation 6(CD6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat cluster of differentiation 6(CD6) ELISA kit |
E06C1491-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat cluster of differentiation 6(CD6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit cluster of differentiation 6(CD6) ELISA kit |
E04C1491-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit cluster of differentiation 6(CD6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit cluster of differentiation 6(CD6) ELISA kit |
E04C1491-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit cluster of differentiation 6(CD6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit cluster of differentiation 6(CD6) ELISA kit |
E04C1491-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit cluster of differentiation 6(CD6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse cluster of differentiation 6(CD6) ELISA kit |
E03C1491-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse cluster of differentiation 6(CD6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse cluster of differentiation 6(CD6) ELISA kit |
E03C1491-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse cluster of differentiation 6(CD6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse cluster of differentiation 6(CD6) ELISA kit |
E03C1491-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse cluster of differentiation 6(CD6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig cluster of differentiation 6(CD6) ELISA kit |
E07C1491-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine cluster of differentiation 6(CD6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig cluster of differentiation 6(CD6) ELISA kit |
E07C1491-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine cluster of differentiation 6(CD6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig cluster of differentiation 6(CD6) ELISA kit |
E07C1491-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine cluster of differentiation 6(CD6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Growth Differentiation Factor 6 (GDF6) ELISA Kit |
abx254118-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Rat Growth Differentiation Factor 6 (GDF6) ELISA Kit |
abx256955-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Monkey cluster of differentiation 6(CD6) ELISA kit |
E09C1491-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey cluster of differentiation 6(CD6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey cluster of differentiation 6(CD6) ELISA kit |
E09C1491-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey cluster of differentiation 6(CD6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey cluster of differentiation 6(CD6) ELISA kit |
E09C1491-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey cluster of differentiation 6(CD6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog cluster of differentiation 6(CD6) ELISA kit |
E08C1491-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine cluster of differentiation 6(CD6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog cluster of differentiation 6(CD6) ELISA kit |
E08C1491-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine cluster of differentiation 6(CD6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog cluster of differentiation 6(CD6) ELISA kit |
E08C1491-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine cluster of differentiation 6(CD6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Growth/differentiation factor 6, Gdf6 ELISA KIT |
ELI-31265m |
Lifescience Market |
96 Tests |
EUR 865 |
Bovine Growth/differentiation factor 6, GDF6 ELISA KIT |
ELI-26549b |
Lifescience Market |
96 Tests |
EUR 928 |
Canine cluster of differentiation 6,CD6 ELISA Kit |
CN-00926C1 |
ChemNorm |
96T |
EUR 471 |
Canine cluster of differentiation 6,CD6 ELISA Kit |
CN-00926C2 |
ChemNorm |
48T |
EUR 322 |
Mouse cluster of differentiation 6(CD6) ELISA Kit |
CSB-EL004949MO-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitative sandwich ELISA kit for measuring Mouse cluster of differentiation 6 (CD6) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Mouse cluster of differentiation 6(CD6) ELISA Kit |
1-CSB-EL004949MO |
Cusabio |
-
EUR 703.00
-
EUR 4843.00
-
EUR 2570.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitative sandwich ELISA kit for measuring Mouse cluster of differentiation 6(CD6) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Pig Growth Differentiation Factor 6 (GDF6) ELISA Kit |
abx360522-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Rabbit Growth Differentiation Factor 6 (GDF6) ELISA Kit |
abx363095-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Rat Cluster of Differentiation 6 (CD6) ELISA Kit |
abx353582-96tests |
Abbexa |
96 tests |
EUR 786 |
- Shipped within 5-12 working days.
|
Chicken Growth Differentiation Factor 6 (GDF6) ELISA Kit |
abx356607-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Monkey Growth Differentiation Factor 6 (GDF6) ELISA Kit |
abx358914-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Mouse Cluster of Differentiation 6 (CD6) ELISA Kit |
abx514436-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Mouse GDF6(Growth Differentiation Factor 6) ELISA Kit |
EM1067 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.313-20 ng/ml
- Uniprot ID: P43028
- Alias: GDF6/BMP-13/BMP13/CDMP2/GDF16/GDF-6/growth differentiation factor 6/Growth/differentiation factor 16/growth/differentiation factor 6/KFS/KFS1/KFSL/MCOP4/MCOPCB6/MGC158100/MGC158101/SCDO4/SGM1
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.188 ng/ml |
Rat GDF6(Growth Differentiation Factor 6) ELISA Kit |
ER0989 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 1.563-100 ng/ml
- Uniprot ID: Q6HA10
- Alias: GDF6/BMP-13/BMP13/CDMP2/GDF16/GDF-6/growth differentiation factor 6/Growth/differentiation factor 16/growth/differentiation factor 6/KFS/KFS1/KFSL/MCOP4/MCOPCB6/MGC158100/MGC158101/SCDO4/SGM1
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.938 ng/ml |
Canine Cluster Of Differentiation 6(CD6)ELISA Kit |
GA-E0055CN-48T |
GenAsia Biotech |
48T |
EUR 402 |
Canine Cluster Of Differentiation 6(CD6)ELISA Kit |
GA-E0055CN-96T |
GenAsia Biotech |
96T |
EUR 684 |
GDF6 ELISA Kit| Rat Growth Differentiation Factor 6 ELISA Kit |
EF017761 |
Lifescience Market |
96 Tests |
EUR 689 |
GDF6 ELISA Kit| Mouse Growth Differentiation Factor 6 ELISA Kit |
EF013635 |
Lifescience Market |
96 Tests |
EUR 689 |
NEUROD6 Rabbit pAb |
A15881-100ul |
Abclonal |
100 ul |
EUR 308 |
NEUROD6 Rabbit pAb |
A15881-200ul |
Abclonal |
200 ul |
EUR 459 |
NEUROD6 Rabbit pAb |
A15881-20ul |
Abclonal |
20 ul |
EUR 183 |
NEUROD6 Rabbit pAb |
A15881-50ul |
Abclonal |
50 ul |
EUR 223 |
NEUROD6 Blocking Peptide |
DF2216-BP |
Affbiotech |
1mg |
EUR 195 |
NEUROD6 Conjugated Antibody |
C44673 |
SAB |
100ul |
EUR 397 |
NEUROD6 cloning plasmid |
CSB-CL846677HU-10ug |
Cusabio |
10ug |
EUR 394 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1014
- Sequence: atgttaacactaccgtttgatgagtctgttgtaatgccagaatcccagatgtgcagaaagttttctagagaatgcgaggaccagaagcaaattaagaagccagaaagcttttccaaacagattgtccttcgaggaaagagcatcaaaagggcccctggagaagaaaccgagaaag
- Show more
|
Description: A cloning plasmid for the NEUROD6 gene. |
Anti-NEUROD6 (4G11) |
YF-MA20575 |
Abfrontier |
200 ul |
EUR 363 |
Description: Mouse monoclonal to NEUROD6 |
Anti-NEUROD6 (1B5) |
YF-MA20576 |
Abfrontier |
200 ul |
EUR 363 |
Description: Mouse monoclonal to NEUROD6 |
ExoStd? Lyophilized Exosome Standard (30 µg, U87 MG, 6 vials) |
M1054-6 |
Biovision |
|
EUR 1306 |
ExoStd? Lyophilized Exosome Standard (100 µg, U87 MG, 6 vials) |
M1055-6 |
Biovision |
|
EUR 1616 |
Human Growth Differentiation Factor 6 (GDF6) CLIA Kit |
20-abx493468 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Recombinant human Growth/differentiation factor 6 |
P1871 |
FN Test |
100ug |
Ask for price |
- Uniprot ID: Q6KF10
- Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
|
Description: Recombinant protein for human Growth/differentiation factor 6 |
ExoStd? Lyophilized Exosome Standard (30 µg, COLO1 cell line, 6 vials) |
M1048-6 |
Biovision |
|
EUR 1306 |
ExoStd? Lyophilized Exosome Standard (100 µg, COLO1 cell line, 6 vials) |
M1049-6 |
Biovision |
|
EUR 1616 |
ExoStd? Lyophilized Exosome Standard (30 µg, MM1 cell line, 6 vials) |
M1050-6 |
Biovision |
|
EUR 1306 |
ExoStd? Lyophilized Exosome Standard (100 µg, MM1 cell line, 6 vials) |
M1051-6 |
Biovision |
|
EUR 1616 |
ExoStd? Lyophilized Exosome Standard (30 µg, BLCL21 cell line, 6 vials) |
M1052-6 |
Biovision |
|
EUR 1306 |
ExoStd? Lyophilized Exosome Standard (100 µg, BLCL21 cell line, 6 vials) |
M1053-6 |
Biovision |
|
EUR 1572 |
ExoStd? Lyophilized Exosome Standard (30 µg, HCT116 cell line, 6 vials) |
M1058-6 |
Biovision |
|
EUR 1306 |
ExoStd? Lyophilized Exosome Standard (100 µg, HCT116 cell line, 6 vials) |
M1059-6 |
Biovision |
|
EUR 1616 |
ExoStd? Lyophilized Exosome Standard (30 µg, PC3 cell line, 6 vials) |
M1060-6 |
Biovision |
|
EUR 1306 |
ExoStd? Lyophilized Exosome Standard (100 µg, PC3 cell line, 6 vials) |
M1061-6 |
Biovision |
|
EUR 1616 |
ExoStd? Lyophilized Exosome Standard (30 µg, DAUD1 cell line, 6 vials) |
M1064-6 |
Biovision |
|
EUR 1306 |
ExoStd? Lyophilized Exosome Standard (100 µg, DAUD1 cell line, 6 vials) |
M1065-6 |
Biovision |
|
EUR 1616 |
ExoStd? Lyophilized Exosome Standard (30 µg, A549 cell line, 6 vials) |
M1066-6 |
Biovision |
|
EUR 1306 |
ExoStd? Lyophilized Exosome Standard (100 µg, A549 cell line, 6 vials) |
M1067-6 |
Biovision |
|
EUR 1616 |
ExoStd? Lyophilized Exosome Standard (30 µg, B16F10 cell line, 6 vials) |
M1070-6 |
Biovision |
|
EUR 1306 |
ExoStd? Lyophilized Exosome Standard (1090 µg, B16F10 cell line, 6 vials) |
M1071-6 |
Biovision |
|
EUR 1616 |
NEUROD6 ORF Vector (Human) (pORF) |
ORF007033 |
ABM |
1.0 ug DNA |
EUR 95 |
ExoStd? Lyophilized Exosome Standard (30 µg, BPH-1 cell line, 6 vials) |
M1062-6 |
Biovision |
|
EUR 1306 |
ExoStd? Lyophilized Exosome Standard (100 µg, BPH-1 cell line, 6 vials) |
M1063-6 |
Biovision |
|
EUR 1616 |
ExoStd? Lyophilized Exosome Standard (30 µg, K-562 cell line, 6 vials) |
M1068-6 |
Biovision |
|
EUR 1306 |
ExoStd? Lyophilized Exosome Standard (100 µg, K-562 cell line, 6 vials) |
M1069-6 |
Biovision |
|
EUR 1616 |
ELISA kit for Mouse GDF6 (Growth Differentiation Factor 6) |
E-EL-M1271 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's GDF6 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse GDF6. Standards or samples are added to the micro ELISA plate wells and combined with th
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Mouse GDF6 (Growth Differentiation Factor 6) in samples from Serum, Plasma, Cell supernatant |
ELISA kit for Rat CD6 (Cluster of Differentiation 6) |
E-EL-R0218 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's CD6 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat CD6. Standards or samples are added to the micro ELISA plate wells and combined with the sp
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Rat CD6 (Cluster of Differentiation 6) in samples from Serum, Plasma, Cell supernatant |
ELISA kit for Rat GDF6 (Growth Differentiation Factor 6) |
E-EL-R1089 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's GDF6 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat GDF6. Standards or samples are added to the micro ELISA plate wells and combined with the
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Rat GDF6 (Growth Differentiation Factor 6) in samples from Serum, Plasma, Cell supernatant |
Guinea pig cluster of differentiation 6(CD6) ELISA kit |
E05C1491-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig cluster of differentiation 6(CD6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human NEUROD6(Neurogenic Differentiation 6) ELISA Kit