Human NRGN(Neurogranin) ELISA Kit
Human Neurogranin (NRGN) ELISA Kit |
RD-NRGN-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 662 |
Neurogranin (NRGN) ELISA Kit |
20-abx258434 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Neurogranin (NRGN) ELISA Kit |
20-abx585166 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Neurogranin(NRGN) ELISA kit |
CSB-EL016081HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Neurogranin (NRGN) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Neurogranin(NRGN) ELISA kit |
1-CSB-EL016081HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Neurogranin(NRGN) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human Neurogranin (NRGN) ELISA Kit |
20-abx152496 |
Abbexa |
-
EUR 6642.00
-
EUR 3542.00
-
EUR 825.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Neurogranin (NRGN) ELISA Kit |
abx251757-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
Human NRGN(Neurogranin) ELISA Kit |
EH2396 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 78-5000 pg/ml
- Uniprot ID: Q92686
- Alias: NRGN/RC3/hng
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9pg/ml |
Human NRGN/ Neurogranin ELISA Kit |
E1793Hu |
Sunlong |
1 Kit |
EUR 605 |
Human Neurogranin (NRGN) ELISA Kit |
CEA404Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4273.35 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neurogranin (NRGN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Neurogranin (NRGN) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Neurogranin (NRGN) ELISA Kit |
CEA404Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 439.57 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neurogranin (NRGN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Neurogranin (NRGN) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Neurogranin (NRGN) ELISA Kit |
CEA404Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 585.1 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neurogranin (NRGN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Neurogranin (NRGN) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Neurogranin (NRGN) ELISA Kit |
CEA404Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2332.95 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neurogranin (NRGN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Neurogranin (NRGN) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Neurogranin (NRGN) ELISA Kit |
4-CEA404Hu |
Cloud-Clone |
-
EUR 4324.00
-
EUR 2283.00
-
EUR 586.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Neurogranin elisa. Alternative names of the recognized antigen: Ng
- NEUG
- Protein Kinase C Substrate RC3
|
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Human Neurogranin (NRGN) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Human Neurogranin (NRGN) ELISA Kit |
abx574312-96tests |
Abbexa |
96 tests |
EUR 786 |
- Shipped within 5-12 working days.
|
Human Neurogranin ELISA Kit (NRGN) |
RK01963 |
Abclonal |
96 Tests |
EUR 521 |
Mouse Neurogranin(NRGN) ELISA kit |
CSB-EL016081MO-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse Neurogranin (NRGN) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Mouse Neurogranin(NRGN) ELISA kit |
1-CSB-EL016081MO |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse Neurogranin(NRGN) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Rat Nrgn/ Neurogranin ELISA Kit |
E0697Ra |
Sunlong |
1 Kit |
EUR 646 |
Mouse Nrgn/ Neurogranin ELISA Kit |
E1057Mo |
Sunlong |
1 Kit |
EUR 632 |
Cow Neurogranin (NRGN) ELISA Kit |
abx520791-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse Neurogranin (NRGN) ELISA Kit |
abx520793-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
Rat Neurogranin (NRGN) ELISA Kit |
abx520794-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
Rat Neurogranin ELISA Kit (NRGN) |
RK03848 |
Abclonal |
96 Tests |
EUR 521 |
Neurogranin (NRGN) CLIA Kit |
20-abx491457 |
Abbexa |
-
EUR 8569.00
-
EUR 4560.00
-
EUR 1052.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Neurogranin (NRGN) Antibody |
20-abx006154 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Neurogranin (NRGN) Antibody |
20-abx177756 |
Abbexa |
|
|
|
Neurogranin (NRGN) Antibody |
20-abx173771 |
Abbexa |
-
EUR 314.00
-
EUR 787.00
-
EUR 411.00
-
EUR 154.00
-
EUR 258.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Neurogranin (NRGN) Antibody |
20-abx242298 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Neurogranin (NRGN) Antibody |
abx235676-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
ELISA kit for Human NRGN (Neurogranin) |
ELK3321 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- A monoclonal antibody specific to Neurogranin (NRGN) has been pre-coated onto a microplate. A competitive inhibition reaction is launched between biotin labeled Neurogranin (NRGN) and unlabeled Neurogranin (NRGN) (Standards or samples) with the pre-c
- Show more
|
Description: A competitive Inhibition ELISA kit for detection of Neurogranin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Human NRGN (Neurogranin) |
ELK7646 |
ELK Biotech |
1 plate of 96 wells |
EUR 372 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Neurogranin (NRGN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Neurogranin (NR
- Show more
|
Description: A sandwich ELISA kit for detection of Neurogranin from Human,Mouse,Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Human Neurogranin (NRGN) CLIA Kit |
20-abx490088 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Human Neurogranin (NRGN) Protein |
20-abx654515 |
Abbexa |
-
EUR 523.00
-
EUR 244.00
-
EUR 1497.00
-
EUR 606.00
-
EUR 356.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Human Neurogranin (NRGN) Protein |
20-abx262390 |
Abbexa |
-
EUR 328.00
-
EUR 6397.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
Multi-species Neurogranin (NRGN) ELISA Kit |
CEA404Mi-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Multi-species Neurogranin (NRGN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Multi-species Neurogranin (NRGN) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Multi-species Neurogranin (NRGN) ELISA Kit |
CEA404Mi-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Multi-species Neurogranin (NRGN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Multi-species Neurogranin (NRGN) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Multi-species Neurogranin (NRGN) ELISA Kit |
CEA404Mi-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Multi-species Neurogranin (NRGN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Multi-species Neurogranin (NRGN) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Multi-species Neurogranin (NRGN) ELISA Kit |
CEA404Mi-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Multi-species Neurogranin (NRGN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Multi-species Neurogranin (NRGN) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Multi-species Neurogranin (NRGN) ELISA Kit |
4-CEA404Mi |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Neurogranin elisa. Alternative names of the recognized antigen: Ng
- NEUG
- Protein Kinase C Substrate RC3
|
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Multi-species Neurogranin (NRGN) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species. |
ELISA kit for Rat Neurogranin (NRGN) |
KTE101185-48T |
Abbkine |
48T |
EUR 354 |
Description: Quantitative sandwich ELISA for measuring Rat Neurogranin (NRGN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Neurogranin (NRGN) |
KTE101185-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2252 |
Description: Quantitative sandwich ELISA for measuring Rat Neurogranin (NRGN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Neurogranin (NRGN) |
KTE101185-96T |
Abbkine |
96T |
EUR 572 |
Description: Quantitative sandwich ELISA for measuring Rat Neurogranin (NRGN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Multi-species Neurogranin (NRGN) ELISA Kit |
SEA404Mi-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5189.65 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Multi-species Neurogranin (NRGN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Multi-species Neurogranin (NRGN) in tissue homogenates, cell lysates and other biological fluids. |
Multi-species Neurogranin (NRGN) ELISA Kit |
SEA404Mi-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 515.03 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Multi-species Neurogranin (NRGN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Multi-species Neurogranin (NRGN) in tissue homogenates, cell lysates and other biological fluids. |
Multi-species Neurogranin (NRGN) ELISA Kit |
SEA404Mi-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 692.9 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Multi-species Neurogranin (NRGN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Multi-species Neurogranin (NRGN) in tissue homogenates, cell lysates and other biological fluids. |
Multi-species Neurogranin (NRGN) ELISA Kit |
SEA404Mi-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2818.05 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Multi-species Neurogranin (NRGN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Multi-species Neurogranin (NRGN) in tissue homogenates, cell lysates and other biological fluids. |
Multi-species Neurogranin (NRGN) ELISA Kit |
4-SEA404Mi |
Cloud-Clone |
-
EUR 5240.00
-
EUR 2769.00
-
EUR 693.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Neurogranin elisa. Alternative names of the recognized antigen: Ng
- NEUG
- Protein Kinase C Substrate RC3
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Multi-species Neurogranin (NRGN) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Neurogranin (NRGN) Monoclonal Antibody (Human) |
4-MAA404Hu22 |
Cloud-Clone |
-
EUR 241.00
-
EUR 2417.00
-
EUR 604.00
-
EUR 301.00
-
EUR 211.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Human Neurogranin (NRGN) |
NRGN Neurogranin Human Recombinant Protein |
PROTQ92686 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: NRGN Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 101 amino acids (1-78 a.a.) and having a molecular mass of 10.0kDa (molecular size on SDS-PAGE will appear higher). ;NRGN is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques. |
ELISA kit for Mouse Neurogranin (NRGN) Kit |
KTE71596-48T |
Abbkine |
48T |
EUR 354 |
Description: Quantitative sandwich ELISA for measuring Mouse Neurogranin (NRGN) Kit in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Neurogranin (NRGN) Kit |
KTE71596-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2252 |
Description: Quantitative sandwich ELISA for measuring Mouse Neurogranin (NRGN) Kit in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Neurogranin (NRGN) Kit |
KTE71596-96T |
Abbkine |
96T |
EUR 572 |
Description: Quantitative sandwich ELISA for measuring Mouse Neurogranin (NRGN) Kit in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Polyclonal NRGN / Neurogranin Antibody (Internal) |
AMM06825G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human NRGN / Neurogranin (Internal). This antibody is tested and proven to work in the following applications: |
Neurogranin (NRGN) Monoclonal Antibody (Human), APC |
4-MAA404Hu22-APC |
Cloud-Clone |
-
EUR 336.00
-
EUR 3149.00
-
EUR 881.00
-
EUR 427.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Human Neurogranin (NRGN). This antibody is labeled with APC. |
Neurogranin (NRGN) Monoclonal Antibody (Human), Biotinylated |
4-MAA404Hu22-Biotin |
Cloud-Clone |
-
EUR 305.00
-
EUR 2367.00
-
EUR 704.00
-
EUR 371.00
-
EUR 216.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Human Neurogranin (NRGN). This antibody is labeled with Biotin. |
Neurogranin (NRGN) Monoclonal Antibody (Human), Cy3 |
4-MAA404Hu22-Cy3 |
Cloud-Clone |
-
EUR 407.00
-
EUR 4157.00
-
EUR 1133.00
-
EUR 528.00
-
EUR 245.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Human Neurogranin (NRGN). This antibody is labeled with Cy3. |
Neurogranin (NRGN) Monoclonal Antibody (Human), FITC |
4-MAA404Hu22-FITC |
Cloud-Clone |
-
EUR 289.00
-
EUR 2539.00
-
EUR 724.00
-
EUR 361.00
-
EUR 192.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Human Neurogranin (NRGN). This antibody is labeled with FITC. |
Neurogranin (NRGN) Monoclonal Antibody (Human), HRP |
4-MAA404Hu22-HRP |
Cloud-Clone |
-
EUR 308.00
-
EUR 2745.00
-
EUR 780.00
-
EUR 387.00
-
EUR 203.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Human Neurogranin (NRGN). This antibody is labeled with HRP. |
Neurogranin (NRGN) Monoclonal Antibody (Human), PE |
4-MAA404Hu22-PE |
Cloud-Clone |
-
EUR 289.00
-
EUR 2539.00
-
EUR 724.00
-
EUR 361.00
-
EUR 192.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Human Neurogranin (NRGN). This antibody is labeled with PE. |
Neurogranin (NRGN) Monoclonal Antibody (Human), APC-Cy7 |
4-MAA404Hu22-APC-Cy7 |
Cloud-Clone |
-
EUR 553.00
-
EUR 6178.00
-
EUR 1642.00
-
EUR 734.00
-
EUR 311.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Human Neurogranin (NRGN). This antibody is labeled with APC-Cy7. |
ELISA kit for Human Neurogranin |
EK4821 |
SAB |
96 tests |
EUR 670 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Neurogranin in samples from serum, plasma, tissue homogenates and other biological fluids. |
Neurogranin precursor |
GT41024 |
Neuromics |
100 ug |
EUR 487 |
Neurogranin precursor |
P41019 |
Neuromics |
100 ug Blocking Peptide |
EUR 239 |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
NRGN antibody |
70R-18965 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal NRGN antibody |
NRGN Antibody |
35545-100ul |
SAB |
100ul |
EUR 252 |
NRGN Antibody |
1-CSB-PA793948 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against NRGN. Recognizes NRGN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000 |
NRGN Antibody |
1-CSB-PA016081GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against NRGN. Recognizes NRGN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
NRGN siRNA |
20-abx903658 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NRGN siRNA |
20-abx926396 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NRGN siRNA |
20-abx926397 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Human NRGN shRNA Plasmid |
20-abx953256 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Neurogranin precursor Antibody |
abx432061-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
anti- Neurogranin antibody |
FNab05676 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:500-1:2000
- IHC: 1:20-1:200
- IP: 1:500-1:2000
- Immunogen: neurogranin(protein kinase C substrate, RC3)
- Uniprot ID: Q92686
- Research Area: Neuroscience, Signal Transduction, Developmental biology
|
Description: Antibody raised against Neurogranin |
NRGN Conjugated Antibody |
C35545 |
SAB |
100ul |
EUR 397 |
NRGN cloning plasmid |
CSB-CL849776HU-10ug |
Cusabio |
10ug |
EUR 185 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 237
- Sequence: atggactgctgcaccgagaacgcctgctccaagccggacgacgacattctagacatcccgctggacgatcccggcgccaacgcggccgccgccaaaatccaggcgagttttcggggccacatggcgcggaagaagataaagagcggagagcgcggccggaagggcccgggccctgg
- Show more
|
Description: A cloning plasmid for the NRGN gene. |
NRGN Rabbit pAb |
A8444-100ul |
Abclonal |
100 ul |
EUR 308 |
NRGN Rabbit pAb |
A8444-200ul |
Abclonal |
200 ul |
EUR 459 |
NRGN Rabbit pAb |
A8444-20ul |
Abclonal |
20 ul |
EUR 183 |
NRGN Rabbit pAb |
A8444-50ul |
Abclonal |
50 ul |
EUR 223 |
Anti-NRGN antibody |
STJ110742 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: Neurogranin (NRGN) is the human homolog of the neuron-specific rat RC3/neurogranin gene. This gene encodes a postsynaptic protein kinase substrate that binds calmodulin in the absence of calcium. The NRGN gene contains four exons and three introns. The exons 1 and 2 encode the protein and exons 3 and 4 contain untranslated sequences. It is suggested that the NRGN is a direct target for thyroid hormone in human brain, and that control of expression of this gene could underlay many of the consequences of hypothyroidism on mental states during development as well as in adult subjects. |
NRGN ORF Vector (Human) (pORF) |
ORF007219 |
ABM |
1.0 ug DNA |
EUR 95 |
Anti-Neurogranin precursor Antibody |
A05781 |
BosterBio |
100ug/200ul |
EUR 397 |
Description: Goat Polyclonal Neurogranin precursor Antibody. Validated in IHC and tested in Human, Mouse. |
Neurogranin precursor Antibody (Biotin) |
abx433025-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
Column Packing Kit |
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
PCR Mycoplasma Detection Kit |
M034-Kit |
TOKU-E |
Kit |
EUR 266 |
NRGN protein (His tag) |
80R-3867 |
Fitzgerald |
50 ug |
EUR 327 |
Description: Purified recombinant NRGN protein (His tag) |
Mouse NRGN shRNA Plasmid |
20-abx975246 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Rat NRGN shRNA Plasmid |
20-abx986218 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
NRGN sgRNA CRISPR Lentivector set (Human) |
K1455201 |
ABM |
3 x 1.0 ug |
EUR 339 |
Biotin-LC-Neurogranin (28-43) |
5-00801 |
CHI Scientific |
4 x 1mg |
Ask for price |
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit |
CAS400A-KIT |
SBI |
1 kit (10 rxn) |
EUR 1110 |
|
CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV100PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV105PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV120PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV125PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS700A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS720A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS740A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents) |
CAS510A-KIT |
SBI |
1 Kit |
EUR 805 |
|
Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV200PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV205PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV220PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV225PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
CAS750A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
CAS770A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
CAS790A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)] |
CAS9LIG-KIT |
SBI |
1 Kit |
EUR 153 |
|
Polyclonal NRGN Antibody (C-term) |
AMM06826G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NRGN (C-term). This antibody is tested and proven to work in the following applications: |
Human NRGN(Neurogranin) ELISA Kit