Human OGN(Osteoglycin) ELISA Kit
Human Osteoglycin (OGN) ELISA Kit |
RD-OGN-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Osteoglycin (OGN) ELISA Kit |
RDR-OGN-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Osteoglycin (OGN) ELISA Kit |
RDR-OGN-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Mouse Osteoglycin (OGN) ELISA Kit |
DLR-OGN-Mu-48T |
DL Develop |
48T |
EUR 527 |
- Should the Mouse Osteoglycin (OGN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Osteoglycin (OGN) in samples from tissue homogenates, cell lysates or other biological fluids. |
Mouse Osteoglycin (OGN) ELISA Kit |
DLR-OGN-Mu-96T |
DL Develop |
96T |
EUR 688 |
- Should the Mouse Osteoglycin (OGN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Osteoglycin (OGN) in samples from tissue homogenates, cell lysates or other biological fluids. |
Mouse Osteoglycin (OGN) ELISA Kit |
RD-OGN-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 533 |
Mouse Osteoglycin (OGN) ELISA Kit |
RD-OGN-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 740 |
Mouse Osteoglycin (OGN) ELISA Kit |
RDR-OGN-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Mouse Osteoglycin (OGN) ELISA Kit |
RDR-OGN-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 774 |
Human Osteoglycin (OGN) ELISA Kit |
20-abx152602 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Osteoglycin (OGN) ELISA Kit |
SEC688Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Osteoglycin (OGN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Osteoglycin (OGN) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Human Osteoglycin (OGN) ELISA Kit |
SEC688Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Osteoglycin (OGN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Osteoglycin (OGN) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Human Osteoglycin (OGN) ELISA Kit |
SEC688Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Osteoglycin (OGN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Osteoglycin (OGN) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Human Osteoglycin (OGN) ELISA Kit |
SEC688Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Osteoglycin (OGN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Osteoglycin (OGN) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Human Osteoglycin (OGN) ELISA Kit |
4-SEC688Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Osteoglycin elisa. Alternative names of the recognized antigen: OIF
- SLRR3A
- Mimecan Proteoglycan
- Osteoinductive Factor
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Osteoglycin (OGN) in samples from Serum, plasma, tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Human Osteoglycin ELISA Kit (OGN) |
RK01988 |
Abclonal |
96 Tests |
EUR 521 |
Canine Osteoglycin(OGN)ELISA Kit |
GA-E0083CN-48T |
GenAsia Biotech |
48T |
EUR 402 |
Canine Osteoglycin(OGN)ELISA Kit |
GA-E0083CN-96T |
GenAsia Biotech |
96T |
EUR 684 |
Mouse Osteoglycin (OGN) ELISA Kit |
20-abx154492 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Mouse Osteoglycin (OGN) ELISA Kit |
SEC688Mu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4862.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Osteoglycin (OGN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Osteoglycin (OGN) in Tissue homogenates, cell lysates and other biological fluids. |
Mouse Osteoglycin (OGN) ELISA Kit |
SEC688Mu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 488.08 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Osteoglycin (OGN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Osteoglycin (OGN) in Tissue homogenates, cell lysates and other biological fluids. |
Mouse Osteoglycin (OGN) ELISA Kit |
SEC688Mu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 654.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Osteoglycin (OGN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Osteoglycin (OGN) in Tissue homogenates, cell lysates and other biological fluids. |
Mouse Osteoglycin (OGN) ELISA Kit |
SEC688Mu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2644.8 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Osteoglycin (OGN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Osteoglycin (OGN) in Tissue homogenates, cell lysates and other biological fluids. |
Mouse Osteoglycin (OGN) ELISA Kit |
4-SEC688Mu |
Cloud-Clone |
-
EUR 4913.00
-
EUR 2595.00
-
EUR 655.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Osteoglycin elisa. Alternative names of the recognized antigen: OIF
- SLRR3A
- Mimecan Proteoglycan
- Osteoinductive Factor
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Osteoglycin (OGN) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Mouse Osteoglycin ELISA Kit (OGN) |
RK03091 |
Abclonal |
96 Tests |
EUR 521 |
Human Osteoglycin / Mimecan (OGN) ELISA Kit |
abx572443-96tests |
Abbexa |
96 tests |
EUR 754 |
- Shipped within 5-12 working days.
|
ELISA kit for Human OGN (Osteoglycin) |
E-EL-H2163 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's OGN ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human OGN. Standards or samples are added to the micro ELISA plate wells and combined with the
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Human OGN (Osteoglycin) in samples from Serum, Plasma, Cell supernatant |
ELISA kit for Human OGN (Osteoglycin) |
ELK3335 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Osteoglycin (OGN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Osteoglycin (OGN
- Show more
|
Description: A sandwich ELISA kit for detection of Osteoglycin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Human Osteoglycin / Mimecan (OGN) ELISA Kit |
abx251775-96tests |
Abbexa |
96 tests |
EUR 754 |
- Shipped within 5-12 working days.
|
Osteoglycin (OGN) Antibody |
20-abx100615 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Osteoglycin (OGN) Antibody |
20-abx100616 |
Abbexa |
-
EUR 439.00
-
EUR 133.00
-
EUR 1233.00
-
EUR 592.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Osteoglycin (OGN) Antibody |
20-abx100617 |
Abbexa |
-
EUR 453.00
-
EUR 133.00
-
EUR 1302.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Osteoglycin (OGN) Antibody |
20-abx173914 |
Abbexa |
|
|
|
Osteoglycin (OGN) Antibody |
20-abx177882 |
Abbexa |
|
|
|
Recombinant Osteoglycin (OGN) |
4-RPC688Hu01 |
Cloud-Clone |
-
EUR 494.24
-
EUR 235.00
-
EUR 1578.40
-
EUR 592.80
-
EUR 1085.60
-
EUR 394.00
-
EUR 3796.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P20774
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 14.9kDa
- Isoelectric Point: 9.5
|
Description: Recombinant Human Osteoglycin expressed in: E.coli |
Recombinant Osteoglycin (OGN) |
4-RPC688Mu01 |
Cloud-Clone |
-
EUR 503.20
-
EUR 238.00
-
EUR 1612.00
-
EUR 604.00
-
EUR 1108.00
-
EUR 400.00
-
EUR 3880.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q62000
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 15.2kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Mouse Osteoglycin expressed in: E.coli |
Recombinant Osteoglycin (OGN) |
4-RPC688Ra01 |
Cloud-Clone |
-
EUR 535.46
-
EUR 246.00
-
EUR 1732.96
-
EUR 644.32
-
EUR 1188.64
-
EUR 421.00
-
EUR 4182.40
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: D3ZVB7
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 15.2kDa
- Isoelectric Point: 9.6
|
Description: Recombinant Rat Osteoglycin expressed in: E.coli |
Human Osteoglycin (OGN) CLIA Kit |
20-abx493841 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Human Osteoglycin (OGN) Protein |
20-abx068401 |
Abbexa |
-
EUR 690.00
-
EUR 286.00
-
EUR 2124.00
-
EUR 815.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Cow Osteoglycin / Mimecan (OGN) ELISA Kit |
abx520882-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Chicken Osteoglycin / Mimecan (OGN) ELISA Kit |
abx520883-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse Osteoglycin / Mimecan (OGN) ELISA Kit |
abx571728-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
ELISA kit for Mouse OGN (Osteoglycin) |
ELK7069 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Osteoglycin (OGN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Osteoglycin (OGN
- Show more
|
Description: A sandwich ELISA kit for detection of Osteoglycin from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Mouse Osteoglycin (OGN) CLIA Kit |
20-abx493842 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Mouse Osteoglycin (OGN) Protein |
20-abx068402 |
Abbexa |
-
EUR 704.00
-
EUR 286.00
-
EUR 2165.00
-
EUR 829.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Rat Osteoglycin (OGN) Protein |
20-abx068403 |
Abbexa |
-
EUR 746.00
-
EUR 300.00
-
EUR 2332.00
-
EUR 885.00
-
EUR 523.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Osteoglycin (OGN) Antibody (Biotin) |
20-abx272291 |
Abbexa |
-
EUR 453.00
-
EUR 244.00
-
EUR 1316.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Osteoglycin (OGN) Antibody (Biotin) |
20-abx272961 |
Abbexa |
-
EUR 467.00
-
EUR 244.00
-
EUR 1344.00
-
EUR 634.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Osteoglycin (OGN) Antibody (Biotin) |
20-abx273373 |
Abbexa |
-
EUR 481.00
-
EUR 244.00
-
EUR 1414.00
-
EUR 662.00
-
EUR 356.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Osteoglycin (OGN) Polyclonal Antibody (Human) |
4-PAC688Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: OGN (Leu180~Phe298)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Osteoglycin (OGN) |
Osteoglycin (OGN) Polyclonal Antibody (Mouse) |
4-PAC688Mu01 |
Cloud-Clone |
-
EUR 251.00
-
EUR 2576.00
-
EUR 640.00
-
EUR 316.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: OGN (Leu180~Phe298)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Osteoglycin (OGN) |
Osteoglycin (OGN) Polyclonal Antibody (Rat) |
4-PAC688Ra01 |
Cloud-Clone |
-
EUR 259.00
-
EUR 2708.00
-
EUR 670.00
-
EUR 328.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: OGN (Leu180~Phe298)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Osteoglycin (OGN) |
Osteoglycin (OGN) Polyclonal Antibody (Human), APC |
4-PAC688Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: OGN (Leu180~Phe298)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Osteoglycin (OGN). This antibody is labeled with APC. |
Osteoglycin (OGN) Polyclonal Antibody (Human), Biotinylated |
4-PAC688Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: OGN (Leu180~Phe298)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Osteoglycin (OGN). This antibody is labeled with Biotin. |
Osteoglycin (OGN) Polyclonal Antibody (Human), Cy3 |
4-PAC688Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: OGN (Leu180~Phe298)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Osteoglycin (OGN). This antibody is labeled with Cy3. |
Osteoglycin (OGN) Polyclonal Antibody (Human), FITC |
4-PAC688Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: OGN (Leu180~Phe298)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Osteoglycin (OGN). This antibody is labeled with FITC. |
Osteoglycin (OGN) Polyclonal Antibody (Human), HRP |
4-PAC688Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: OGN (Leu180~Phe298)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Osteoglycin (OGN). This antibody is labeled with HRP. |
Osteoglycin (OGN) Polyclonal Antibody (Human), PE |
4-PAC688Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: OGN (Leu180~Phe298)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Osteoglycin (OGN). This antibody is labeled with PE. |
Osteoglycin (OGN) Polyclonal Antibody (Human), APC-Cy7 |
4-PAC688Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: OGN (Leu180~Phe298)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Osteoglycin (OGN). This antibody is labeled with APC-Cy7. |
Osteoglycin (OGN) Polyclonal Antibody (Mouse), APC |
4-PAC688Mu01-APC |
Cloud-Clone |
-
EUR 351.00
-
EUR 3365.00
-
EUR 935.00
-
EUR 449.00
-
EUR 222.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: OGN (Leu180~Phe298)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Osteoglycin (OGN). This antibody is labeled with APC. |
Osteoglycin (OGN) Polyclonal Antibody (Mouse), Biotinylated |
4-PAC688Mu01-Biotin |
Cloud-Clone |
-
EUR 316.00
-
EUR 2526.00
-
EUR 744.00
-
EUR 387.00
-
EUR 221.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: OGN (Leu180~Phe298)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Osteoglycin (OGN). This antibody is labeled with Biotin. |
Osteoglycin (OGN) Polyclonal Antibody (Mouse), Cy3 |
4-PAC688Mu01-Cy3 |
Cloud-Clone |
-
EUR 427.00
-
EUR 4445.00
-
EUR 1205.00
-
EUR 557.00
-
EUR 254.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: OGN (Leu180~Phe298)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Osteoglycin (OGN). This antibody is labeled with Cy3. |
Osteoglycin (OGN) Polyclonal Antibody (Mouse), FITC |
4-PAC688Mu01-FITC |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: OGN (Leu180~Phe298)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Osteoglycin (OGN). This antibody is labeled with FITC. |
Osteoglycin (OGN) Polyclonal Antibody (Mouse), HRP |
4-PAC688Mu01-HRP |
Cloud-Clone |
-
EUR 321.00
-
EUR 2933.00
-
EUR 827.00
-
EUR 405.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: OGN (Leu180~Phe298)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Osteoglycin (OGN). This antibody is labeled with HRP. |
Osteoglycin (OGN) Polyclonal Antibody (Mouse), PE |
4-PAC688Mu01-PE |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: OGN (Leu180~Phe298)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Osteoglycin (OGN). This antibody is labeled with PE. |
Osteoglycin (OGN) Polyclonal Antibody (Rat), APC |
4-PAC688Ra01-APC |
Cloud-Clone |
-
EUR 364.00
-
EUR 3545.00
-
EUR 980.00
-
EUR 467.00
-
EUR 227.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: OGN (Leu180~Phe298)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Osteoglycin (OGN). This antibody is labeled with APC. |
Osteoglycin (OGN) Polyclonal Antibody (Rat), Biotinylated |
4-PAC688Ra01-Biotin |
Cloud-Clone |
-
EUR 325.00
-
EUR 2658.00
-
EUR 777.00
-
EUR 400.00
-
EUR 225.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: OGN (Leu180~Phe298)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Osteoglycin (OGN). This antibody is labeled with Biotin. |
Osteoglycin (OGN) Polyclonal Antibody (Rat), Cy3 |
4-PAC688Ra01-Cy3 |
Cloud-Clone |
-
EUR 444.00
-
EUR 4685.00
-
EUR 1265.00
-
EUR 581.00
-
EUR 261.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: OGN (Leu180~Phe298)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Osteoglycin (OGN). This antibody is labeled with Cy3. |
Osteoglycin (OGN) Polyclonal Antibody (Rat), FITC |
4-PAC688Ra01-FITC |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: OGN (Leu180~Phe298)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Osteoglycin (OGN). This antibody is labeled with FITC. |
Osteoglycin (OGN) Polyclonal Antibody (Rat), HRP |
4-PAC688Ra01-HRP |
Cloud-Clone |
-
EUR 332.00
-
EUR 3089.00
-
EUR 866.00
-
EUR 421.00
-
EUR 213.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: OGN (Leu180~Phe298)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Osteoglycin (OGN). This antibody is labeled with HRP. |
Osteoglycin (OGN) Polyclonal Antibody (Rat), PE |
4-PAC688Ra01-PE |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: OGN (Leu180~Phe298)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Osteoglycin (OGN). This antibody is labeled with PE. |
Recombinant Human OGN/ osteoglycin Protein, His, E.coli-100ug |
QP6449-ec-100ug |
EnQuireBio |
100ug |
EUR 408 |
Recombinant Human OGN/ osteoglycin Protein, His, E.coli-10ug |
QP6449-ec-10ug |
EnQuireBio |
10ug |
EUR 200 |
Recombinant Human OGN/ osteoglycin Protein, His, E.coli-1mg |
QP6449-ec-1mg |
EnQuireBio |
1mg |
EUR 1632 |
Recombinant Human OGN/ osteoglycin Protein, His, E.coli-200ug |
QP6449-ec-200ug |
EnQuireBio |
200ug |
EUR 634 |
Recombinant Human OGN/ osteoglycin Protein, His, E.coli-500ug |
QP6449-ec-500ug |
EnQuireBio |
500ug |
EUR 1060 |
Recombinant Human OGN/ osteoglycin Protein, His, E.coli-50ug |
QP6449-ec-50ug |
EnQuireBio |
50ug |
EUR 263 |
Recombinant Human OGN/ osteoglycin Protein, His, Yeast-100ug |
QP6449-ye-100ug |
EnQuireBio |
100ug |
EUR 480 |
Recombinant Human OGN/ osteoglycin Protein, His, Yeast-10ug |
QP6449-ye-10ug |
EnQuireBio |
10ug |
EUR 236 |
Recombinant Human OGN/ osteoglycin Protein, His, Yeast-1mg |
QP6449-ye-1mg |
EnQuireBio |
1mg |
EUR 1885 |
Recombinant Human OGN/ osteoglycin Protein, His, Yeast-200ug |
QP6449-ye-200ug |
EnQuireBio |
200ug |
EUR 744 |
Recombinant Human OGN/ osteoglycin Protein, His, Yeast-500ug |
QP6449-ye-500ug |
EnQuireBio |
500ug |
EUR 1206 |
Recombinant Human OGN/ osteoglycin Protein, His, Yeast-50ug |
QP6449-ye-50ug |
EnQuireBio |
50ug |
EUR 299 |
Osteoglycin (OGN) Polyclonal Antibody (Mouse), APC-Cy7 |
4-PAC688Mu01-APC-Cy7 |
Cloud-Clone |
-
EUR 583.00
-
EUR 6610.00
-
EUR 1750.00
-
EUR 778.00
-
EUR 324.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: OGN (Leu180~Phe298)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Osteoglycin (OGN). This antibody is labeled with APC-Cy7. |
Osteoglycin (OGN) Polyclonal Antibody (Rat), APC-Cy7 |
4-PAC688Ra01-APC-Cy7 |
Cloud-Clone |
-
EUR 608.00
-
EUR 6970.00
-
EUR 1840.00
-
EUR 814.00
-
EUR 335.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: OGN (Leu180~Phe298)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Osteoglycin (OGN). This antibody is labeled with APC-Cy7. |
Human Osteoglycin ELISA kit |
E01O0853-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Osteoglycin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Osteoglycin ELISA kit |
E01O0853-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Osteoglycin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Osteoglycin ELISA kit |
E01O0853-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Osteoglycin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Osteoglycin (Osteoglycin) Antibody |
abx236032-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Rat Osteoglycin ELISA kit |
E02O0853-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Osteoglycin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Osteoglycin ELISA kit |
E02O0853-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Osteoglycin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Osteoglycin ELISA kit |
E02O0853-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Osteoglycin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Osteoglycin ELISA kit |
E03O0853-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Osteoglycin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Osteoglycin ELISA kit |
E03O0853-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Osteoglycin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Osteoglycin ELISA kit |
E03O0853-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Osteoglycin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Osteoglycin ELISA kit |
E04O0853-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Osteoglycin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Osteoglycin ELISA kit |
E04O0853-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Osteoglycin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Osteoglycin ELISA kit |
E04O0853-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Osteoglycin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Osteoglycin ELISA kit |
E06O0853-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Osteoglycin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Osteoglycin ELISA kit |
E06O0853-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Osteoglycin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Osteoglycin ELISA kit |
E06O0853-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Osteoglycin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Osteoglycin ELISA kit |
E07O0853-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Porcine Osteoglycin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Osteoglycin ELISA kit |
E07O0853-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Porcine Osteoglycin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Osteoglycin ELISA kit |
E07O0853-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Porcine Osteoglycin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Osteoglycin ELISA kit |
E08O0853-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Canine Osteoglycin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Osteoglycin ELISA kit |
E08O0853-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Canine Osteoglycin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Osteoglycin ELISA kit |
E08O0853-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Canine Osteoglycin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Osteoglycin ELISA kit |
E09O0853-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Monkey Osteoglycin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Osteoglycin ELISA kit |
E09O0853-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Monkey Osteoglycin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Osteoglycin ELISA kit |
E09O0853-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Monkey Osteoglycin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human OGN/ Mimecan ELISA Kit |
E1824Hu |
Sunlong |
1 Kit |
EUR 605 |
Human OGN(Mimecan) ELISA Kit |
EH2412 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: P20774
- Alias: OGN/Osteoglycin/Osteoinductive factor/KSPG25/OIF/SLRR3A/DKFZp586P2421/mimecan/mimecan proteoglycan/OIFOG/Osteoglycin/osteoglycin/osteoglycin(osteoinductive factor)/Osteoinductive factor/SLRR3A
- Show more
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
Human Mimecan (OGN) ELISA kit |
CSB-EL016314HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Mimecan (OGN) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Mimecan (OGN) ELISA kit |
1-CSB-EL016314HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Mimecan (OGN) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Guinea pig Osteoglycin ELISA kit |
E05O0853-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Guinea pig Osteoglycin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Osteoglycin ELISA kit |
E05O0853-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Guinea pig Osteoglycin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Osteoglycin ELISA kit |
E05O0853-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Guinea pig Osteoglycin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Ogn/ Mimecan ELISA Kit |
E1077Mo |
Sunlong |
1 Kit |
EUR 632 |
Human Mimecan (OGN) |
1-CSB-YP016314HU |
Cusabio |
-
EUR 430.00
-
EUR 234.00
-
EUR 1508.00
-
EUR 642.00
-
EUR 1009.00
-
EUR 291.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 33.7 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Mimecan(OGN) expressed in Yeast |
Human Mimecan (OGN) |
1-CSB-EP016314HU |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 35.7 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Mimecan(OGN) expressed in E.coli |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
OGN siRNA |
20-abx926812 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
OGN siRNA |
20-abx926813 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
OGN antibody |
70R-19033 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal OGN antibody |
OGN Antibody |
1-CSB-PA005349 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against OGN. Recognizes OGN from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000 |
OGN Antibody |
1-CSB-PA016314ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against OGN. Recognizes OGN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
OGN Antibody |
1-CSB-PA016314GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against OGN. Recognizes OGN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
OGN Antibody |
1-CSB-PA016314LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against OGN. Recognizes OGN from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:300, IF:1:50-1:200 |
Human OGN shRNA Plasmid |
20-abx953298 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
OGN Recombinant Protein (Human) |
RP022081 |
ABM |
100 ug |
Ask for price |
Osteoglycin Polyclonal Antibody |
ES4024-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Osteoglycin from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
Osteoglycin Polyclonal Antibody |
ES4024-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Osteoglycin from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
anti- Osteoglycin antibody |
FNab06032 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: osteoglycin
- Uniprot ID: P20774
- Research Area: Immunology, Signal Transduction
|
Description: Antibody raised against Osteoglycin |
Osteoglycin Polyclonal Antibody |
20-abx116879 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Osteoglycin Polyclonal Antibody |
ABP53025-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from the C-terminal region of human Osteoglycin
- Applications tips:
|
Description: A polyclonal antibody for detection of Osteoglycin from Human, Mouse. This Osteoglycin antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human Osteoglycin |
Osteoglycin Polyclonal Antibody |
ABP53025-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from the C-terminal region of human Osteoglycin
- Applications tips:
|
Description: A polyclonal antibody for detection of Osteoglycin from Human, Mouse. This Osteoglycin antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human Osteoglycin |
Osteoglycin Polyclonal Antibody |
ABP53025-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from the C-terminal region of human Osteoglycin
- Applications tips:
|
Description: A polyclonal antibody for detection of Osteoglycin from Human, Mouse. This Osteoglycin antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human Osteoglycin |
Anti-Osteoglycin Antibody |
A07061 |
BosterBio |
100ul |
EUR 397 |
Description: Rabbit Polyclonal Antibody for Osteoglycin Antibody (OGN) detection. Tested with WB in Human, Mouse. |
Osteoglycin Polyclonal Antibody |
41700-100ul |
SAB |
100ul |
EUR 252 |
Osteoglycin Polyclonal Antibody |
41700-50ul |
SAB |
50ul |
EUR 187 |
Anti-Osteoglycin antibody |
STJ96659 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to Osteoglycin. |
OGN cloning plasmid |
CSB-CL016314HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 897
- Sequence: atgaagactctgcagtctacacttctcctgttactgcttgtgcctctgataaagccagcaccaccaacccagcaggactcacgcattatctatgattatggaacagataattttgaagaatccatatttagccaagattatgaggataaatacctggatggaaaaaatattaagga
- Show more
|
Description: A cloning plasmid for the OGN gene. |
Mimecan (OGN) Antibody |
20-abx006381 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Mimecan (OGN) Antibody |
abx026375-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Mimecan (OGN) Antibody |
abx026375-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Mimecan (OGN) Antibody |
20-abx325478 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Mimecan (OGN) Antibody |
20-abx320764 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Mimecan (OGN) Antibody |
20-abx304702 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
OGN Polyclonal Antibody |
A57045 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
OGN Rabbit pAb |
A6679-100ul |
Abclonal |
100 ul |
EUR 308 |
OGN Rabbit pAb |
A6679-200ul |
Abclonal |
200 ul |
EUR 459 |
OGN Rabbit pAb |
A6679-20ul |
Abclonal |
20 ul |
EUR 183 |
OGN Rabbit pAb |
A6679-50ul |
Abclonal |
50 ul |
EUR 223 |
OGN Polyclonal Antibody |
30722-100ul |
SAB |
100ul |
EUR 252 |
OGN Polyclonal Antibody |
30722-50ul |
SAB |
50ul |
EUR 187 |
Anti-OGN antibody |
STJ28762 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the small leucine-rich proteoglycan (SLRP) family of proteins. The encoded protein induces ectopic bone formation in conjunction with transforming growth factor beta and may regulate osteoblast differentiation. High expression of the encoded protein may be associated with elevated heart left ventricular mass. Alternative splicing results in multiple transcript variants. |
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
OGN ORF Vector (Human) (pORF) |
ORF007361 |
ABM |
1.0 ug DNA |
EUR 95 |
Column Packing Kit |
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
Osteoglycin Polyclonal Conjugated Antibody |
C41700 |
SAB |
100ul |
EUR 397 |
PCR Mycoplasma Detection Kit |
M034-Kit |
TOKU-E |
Kit |
EUR 266 |
OGN Polyclonal Conjugated Antibody |
C30722 |
SAB |
100ul |
EUR 397 |
Mimecan (OGN) Antibody (HRP) |
20-abx304703 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Mimecan (OGN) Antibody (FITC) |
20-abx304704 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Mimecan (OGN) Antibody (Biotin) |
20-abx304705 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Anti-OIF/Ogn Antibody |
A07061-1 |
BosterBio |
100ug/vial |
EUR 294 |
Mouse OGN shRNA Plasmid |
20-abx971861 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
OGN Antibody, HRP conjugated |
1-CSB-PA016314LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against OGN. Recognizes OGN from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
OGN Antibody, FITC conjugated |
1-CSB-PA016314LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against OGN. Recognizes OGN from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
OGN Antibody, Biotin conjugated |
1-CSB-PA016314LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against OGN. Recognizes OGN from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
OGN Recombinant Protein (Rat) |
RP215105 |
ABM |
100 ug |
Ask for price |
OGN Recombinant Protein (Mouse) |
RP155843 |
ABM |
100 ug |
Ask for price |
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit |
CAS400A-KIT |
SBI |
1 kit (10 rxn) |
EUR 1110 |
|
OGN sgRNA CRISPR Lentivector set (Human) |
K1480501 |
ABM |
3 x 1.0 ug |
EUR 339 |
CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV100PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV105PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV120PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV125PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS700A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS720A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS740A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Human OGN(Osteoglycin) ELISA Kit