Human PAEP(Progestagen Associated Endometrial Protein) ELISA Kit
Human Progestagen Associated Endometrial Protein (PAEP) ELISA Kit |
RD-PAEP-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Progestagen Associated Endometrial Protein (PAEP) ELISA Kit |
RDR-PAEP-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Progestagen Associated Endometrial Protein (PAEP) ELISA Kit |
RDR-PAEP-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Progestagen-Associated Endometrial Protein (PAEP) Protein |
20-abx262595 |
Abbexa |
-
EUR 328.00
-
EUR 6397.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
Progestagen-Associated Endometrial Protein (PAEP) Antibody |
20-abx126995 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Progestagen-Associated Endometrial Protein (PAEP) Antibody |
20-abx004400 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Progestagen-Associated Endometrial Protein (PAEP) Antibody |
abx028157-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Progestagen-Associated Endometrial Protein (PAEP) Antibody |
abx028157-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Progestagen Associated Endometrial Protein (PAEP) Antibody |
20-abx174167 |
Abbexa |
|
|
|
Progestagen Associated Endometrial Protein (PAEP) Antibody |
20-abx178096 |
Abbexa |
|
|
|
Progestagen-Associated Endometrial Protein (PAEP) Antibody |
20-abx301834 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Progestagen-Associated Endometrial Protein (PAEP) Antibody |
20-abx211693 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Progestagen-Associated Endometrial Protein (PAEP) Antibody |
20-abx213124 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Human Progestagen Associated Endometrial Protein (PAEP) ELISA Kit |
20-abx152622 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Progestagen Associated Endometrial Protein (PAEP) ELISA Kit |
SEC709Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Progestagen Associated Endometrial Protein (PAEP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Progestagen Associated Endometrial Protein (PAEP) in serum, plasma, tissue homogenates and other biological fluids. |
Human Progestagen Associated Endometrial Protein (PAEP) ELISA Kit |
SEC709Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Progestagen Associated Endometrial Protein (PAEP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Progestagen Associated Endometrial Protein (PAEP) in serum, plasma, tissue homogenates and other biological fluids. |
Human Progestagen Associated Endometrial Protein (PAEP) ELISA Kit |
SEC709Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Progestagen Associated Endometrial Protein (PAEP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Progestagen Associated Endometrial Protein (PAEP) in serum, plasma, tissue homogenates and other biological fluids. |
Human Progestagen Associated Endometrial Protein (PAEP) ELISA Kit |
SEC709Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Progestagen Associated Endometrial Protein (PAEP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Progestagen Associated Endometrial Protein (PAEP) in serum, plasma, tissue homogenates and other biological fluids. |
Human Progestagen Associated Endometrial Protein (PAEP) ELISA Kit |
4-SEC709Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Progestagen Associated Endometrial Protein elisa. Alternative names of the recognized antigen: GD
- GdA
- GdF
- GdS
- PAEG
- PEP
- PP14
- Glycodelin
- Placental Protein 14
- Alpha Uterine Protein
- Pregnancy-Associated Endometrial Alpha-2-Globuli
- Show more
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Progestagen Associated Endometrial Protein (PAEP) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Human Progestagen Associated Endometrial Protein ELISA Kit (PAEP) |
RK02007 |
Abclonal |
96 Tests |
EUR 521 |
Human Progestagen Associated Endometrial Protein(PAEP)ELISA Kit |
QY-E01907 |
Qayee Biotechnology |
96T |
EUR 361 |
Human Progestagen Associated Endometrial Protein (PAEP) Protein |
20-abx654801 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Monkey Progestagen-Associated Endometrial Protein (PAEP) ELISA Kit |
abx359635-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Pig Progestagen-Associated Endometrial Protein (PAEP) ELISA Kit |
abx361451-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Rabbit Progestagen-Associated Endometrial Protein (PAEP) ELISA Kit |
abx362423-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Sheep Progestagen-Associated Endometrial Protein (PAEP) ELISA Kit |
abx364352-96tests |
Abbexa |
96 tests |
EUR 926 |
- Shipped within 5-12 working days.
|
Chicken Progestagen-Associated Endometrial Protein (PAEP) ELISA Kit |
abx356335-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Human Progestagen Associated Endometrial Protein (PAEP) CLIA Kit |
20-abx493852 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Human Progestagen-Associated Endometrial Protein (PAEP) CLIA Kit |
abx197540-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
ELISA kit for Human PAEP (Progestagen Associated Endometrial Protein) |
ELK3531 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Progestagen Associated Endometrial Protein (PAEP). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antib
- Show more
|
Description: A sandwich ELISA kit for detection of Progestagen Associated Endometrial Protein from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Human Progestagen Associated Endometrial Protein (PAEP) |
KTE61318-48T |
Abbkine |
48T |
EUR 354 |
- Glycodelin is a member of the kernel lipocalin superfamily whose members share relatively low sequence similarity but have highly conserved exon/intron structure and three-dimensional protein folding. Most lipocalins are clustered on the long arm of
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Progestagen Associated Endometrial Protein (PAEP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Progestagen Associated Endometrial Protein (PAEP) |
KTE61318-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2252 |
- Glycodelin is a member of the kernel lipocalin superfamily whose members share relatively low sequence similarity but have highly conserved exon/intron structure and three-dimensional protein folding. Most lipocalins are clustered on the long arm of
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Progestagen Associated Endometrial Protein (PAEP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Progestagen Associated Endometrial Protein (PAEP) |
KTE61318-96T |
Abbkine |
96T |
EUR 572 |
- Glycodelin is a member of the kernel lipocalin superfamily whose members share relatively low sequence similarity but have highly conserved exon/intron structure and three-dimensional protein folding. Most lipocalins are clustered on the long arm of
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Progestagen Associated Endometrial Protein (PAEP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Progestagen-Associated Endometrial Protein (PAEP) Antibody (HRP) |
20-abx315904 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Progestagen-Associated Endometrial Protein (PAEP) Antibody (FITC) |
20-abx315905 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Progestagen-Associated Endometrial Protein (PAEP) Antibody (Biotin) |
20-abx315906 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
PAEP Progesterone-Associated Endometrial Protein Human Recombinant Protein |
PROTP09466 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: PAEP Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 185 amino acids (19-180a.a) and having a molecular mass of 21kDa. ;PAEP is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques. |
Human PAEP/ Glycodelin ELISA Kit |
E1860Hu |
Sunlong |
1 Kit |
EUR 605 |
Human PAEP(Glycodelin) ELISA Kit |
EH1142 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: P09466
- Alias: PAEP(Progestagen-Associated Endometrial Protein)/Glycodelin/PP14/alpha uterine protein/GdF/GdS/glycodelin-A/glycodelin-F/glycodelin-S/PEP/Placental protein 14/Pregnancy-associated endometrial
- Show more
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
Human Glycodelin (PAEP) ELISA Kit |
abx250392-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
PAEP Recombinant Protein (Human) |
RP022438 |
ABM |
100 ug |
Ask for price |
Human Glycodelin (PAEP) |
1-CSB-EP017381HU |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 22.4 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Glycodelin(PAEP) expressed in E.coli |
Human Glycodelin (PAEP) |
1-CSB-MP017381HU |
Cusabio |
-
EUR 358.00
-
EUR 1257.00
-
EUR 514.00
-
EUR 927.00
|
|
- MW: 23.9 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Glycodelin(PAEP) expressed in Mammalian cell |
Human Endometrial Adenocarcinoma CAFs |
CAF01 |
Neuromics |
1,000,000 cells |
EUR 1223 |
PAEP siRNA |
20-abx927607 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PAEP Antibody |
33016-100ul |
SAB |
100ul |
EUR 252 |
PAEP Antibody |
DF2701 |
Affbiotech |
200ul |
EUR 304 |
Description: PAEP antibody detects endogenous levels of total PAEP. |
PAEP Antibody |
1-CSB-PA198597 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against PAEP. Recognizes PAEP from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:100-1:300 |
PAEP Antibody |
1-CSB-PA043641 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against PAEP. Recognizes PAEP from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:100-1:300 |
PAEP Antibody |
1-CSB-PA017381LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PAEP. Recognizes PAEP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IP; Recommended dilution: IHC:1:20-1:200, IP:1:200-1:2000 |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
PAEP protein (His tag) |
80R-2711 |
Fitzgerald |
50 ug |
EUR 424 |
Description: Purified recombinant PAEP protein (His tag) |
Human PAEP shRNA Plasmid |
20-abx953353 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
PAEP Conjugated Antibody |
C33016 |
SAB |
100ul |
EUR 397 |
PAEP cloning plasmid |
CSB-CL017381HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 543
- Sequence: atgctgtgcctcctgctcaccctgggcgtggccctggtctgtggtgtcccggccatggacatcccccagaccaagcaggacctggagctcccaaagttggcagggacctggcactccatggccatggcgaccaacaacatctccctcatggcgacactgaaggcccctctgagggt
- Show more
|
Description: A cloning plasmid for the PAEP gene. |
PAEP Polyclonal Antibody |
ES10976-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against PAEP from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
PAEP Polyclonal Antibody |
ES10976-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against PAEP from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
PAEP Polyclonal Antibody |
ABP59813-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human PAEP protein
- Applications tips:
|
Description: A polyclonal antibody for detection of PAEP from Human. This PAEP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PAEP protein |
PAEP Polyclonal Antibody |
ABP59813-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human PAEP protein
- Applications tips:
|
Description: A polyclonal antibody for detection of PAEP from Human. This PAEP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PAEP protein |
PAEP Polyclonal Antibody |
ABP59813-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human PAEP protein
- Applications tips:
|
Description: A polyclonal antibody for detection of PAEP from Human. This PAEP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PAEP protein |
PAEP Rabbit pAb |
A11810-100ul |
Abclonal |
100 ul |
EUR 308 |
PAEP Rabbit pAb |
A11810-200ul |
Abclonal |
200 ul |
EUR 459 |
PAEP Rabbit pAb |
A11810-20ul |
Abclonal |
20 ul |
Ask for price |
PAEP Rabbit pAb |
A11810-50ul |
Abclonal |
50 ul |
Ask for price |
PAEP Rabbit pAb |
A5751-100ul |
Abclonal |
100 ul |
EUR 308 |
PAEP Rabbit pAb |
A5751-200ul |
Abclonal |
200 ul |
EUR 459 |
PAEP Rabbit pAb |
A5751-20ul |
Abclonal |
20 ul |
EUR 183 |
PAEP Rabbit pAb |
A5751-50ul |
Abclonal |
50 ul |
EUR 223 |
PAEP Rabbit pAb |
A14757-100ul |
Abclonal |
100 ul |
EUR 308 |
PAEP Rabbit pAb |
A14757-200ul |
Abclonal |
200 ul |
EUR 459 |
PAEP Rabbit pAb |
A14757-20ul |
Abclonal |
20 ul |
EUR 183 |
PAEP Rabbit pAb |
A14757-50ul |
Abclonal |
50 ul |
EUR 223 |
PAEP Blocking Peptide |
DF2701-BP |
Affbiotech |
1mg |
EUR 195 |
Anti-PAEP antibody |
STJ28318 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene is a member of the kernel lipocalin superfamily whose members share relatively low sequence similarity but have highly conserved exon/intron structure and three-dimensional protein folding. Most lipocalins are clustered on the long arm of chromosome 9. The encoded glycoprotein has been previously referred to as pregnancy-associated endometrial alpha-2-globulin, placental protein 14, and glycodelin, but has been officially named progestagen-associated endometrial protein. Three distinct forms, with identical protein backbones but different glycosylation profiles, are found in amniotic fluid, follicular fluid and seminal plasma of the reproductive system. These glycoproteins have distinct and essential roles in regulating a uterine environment suitable for pregnancy and in the timing and occurrence of the appropriate sequence of events in the fertilization process. Alternative splicing results in multiple transcript variants. |
Anti-PAEP antibody |
STJ113389 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene is a member of the kernel lipocalin superfamily whose members share relatively low sequence similarity but have highly conserved exon/intron structure and three-dimensional protein folding. Most lipocalins are clustered on the long arm of chromosome 9. The encoded glycoprotein has been previously referred to as pregnancy-associated endometrial alpha-2-globulin, placental protein 14, and glycodelin, but has been officially named progestagen-associated endometrial protein. Three distinct forms, with identical protein backbones but different glycosylation profiles, are found in amniotic fluid, follicular fluid and seminal plasma of the reproductive system. These glycoproteins have distinct and essential roles in regulating a uterine environment suitable for pregnancy and in the timing and occurrence of the appropriate sequence of events in the fertilization process. Alternative splicing results in multiple transcript variants. |
Anti-PAEP antibody |
STJ116957 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene is a member of the kernel lipocalin superfamily whose members share relatively low sequence similarity but have highly conserved exon/intron structure and three-dimensional protein folding. Most lipocalins are clustered on the long arm of chromosome 9. The encoded glycoprotein has been previously referred to as pregnancy-associated endometrial alpha-2-globulin, placental protein 14, and glycodelin, but has been officially named progestagen-associated endometrial protein. Three distinct forms, with identical protein backbones but different glycosylation profiles, are found in amniotic fluid, follicular fluid and seminal plasma of the reproductive system. These glycoproteins have distinct and essential roles in regulating a uterine environment suitable for pregnancy and in the timing and occurrence of the appropriate sequence of events in the fertilization process. Alternative splicing results in multiple transcript variants. |
Anti-PAEP antibody |
STJ192134 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to PAEP |
PAEP ORF Vector (Human) (pORF) |
ORF007480 |
ABM |
1.0 ug DNA |
EUR 95 |
PAEP Protein Vector (Human) (pPB-C-His) |
PV029917 |
ABM |
500 ng |
EUR 329 |
PAEP Protein Vector (Human) (pPB-N-His) |
PV029918 |
ABM |
500 ng |
EUR 329 |
PAEP Protein Vector (Human) (pPM-C-HA) |
PV029919 |
ABM |
500 ng |
EUR 329 |
PAEP Protein Vector (Human) (pPM-C-His) |
PV029920 |
ABM |
500 ng |
EUR 329 |
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit |
CAS400A-KIT |
SBI |
1 kit (10 rxn) |
EUR 1110 |
|
Immortalized Human Endometrial Stromal Cells-SV40 |
T9201 |
ABM |
1x106 cells / 1.0 ml |
EUR 1500 |
Immortalized Human Endometrial Stromal Cells (HESC) |
T0533 |
ABM |
1x106 cells / 1.0 ml |
EUR 1500 |
PAEP Antibody, HRP conjugated |
1-CSB-PA017381LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PAEP. Recognizes PAEP from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
PAEP Antibody, FITC conjugated |
1-CSB-PA017381LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PAEP. Recognizes PAEP from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
PAEP Antibody, Biotin conjugated |
1-CSB-PA017381LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PAEP. Recognizes PAEP from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
EM (Anti-endometrial Antibody IgG) ELISA test |
56 |
Biobase |
96T/Box |
Ask for price |
- Area of application: Immunological infertility
|
Description: ELISA based test for quantitative detection of EM (Anti-endometrial Antibody IgG) |
EM (Anti-endometrial Antibody IgM) ELISA test |
57 |
Biobase |
96T/Box |
Ask for price |
- Area of application: Immunological infertility
|
Description: ELISA based test for quantitative detection of EM (Anti-endometrial Antibody IgM) |
EM (Anti-endometrial Antibody IgA) ELISA test |
58 |
Biobase |
96T/Box |
Ask for price |
- Area of application: Immunological infertility
|
Description: ELISA based test for quantitative detection of EM (Anti-endometrial Antibody IgA) |
PAEP sgRNA CRISPR Lentivector set (Human) |
K1587501 |
ABM |
3 x 1.0 ug |
EUR 339 |
Column Packing Kit |
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
PCR Mycoplasma Detection Kit |
M034-Kit |
TOKU-E |
Kit |
EUR 266 |
Human Cervix PrimaCell4: Normal Endometrial Epithelial Cells |
2-96047 |
CHI Scientific |
1 Kit |
Ask for price |
Human Cytotoxin- associated protein ELISA Kit |
ELA-E1229h |
Lifescience Market |
96 Tests |
EUR 824 |
PAEP sgRNA CRISPR Lentivector (Human) (Target 1) |
K1587502 |
ABM |
1.0 ug DNA |
EUR 154 |
PAEP sgRNA CRISPR Lentivector (Human) (Target 2) |
K1587503 |
ABM |
1.0 ug DNA |
EUR 154 |
PAEP sgRNA CRISPR Lentivector (Human) (Target 3) |
K1587504 |
ABM |
1.0 ug DNA |
EUR 154 |
Human Vesicle-associated membrane protein-associated protein A (VAPA) ELISA Kit |
abx384213-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Endometrial Tumor Tissue Array - 12 cases of endometrial cancer paired with adjacent normal tissues |
Z7020023 |
Biochain |
5 slides |
EUR 1381 |
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool. |
CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV100PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV105PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV120PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV125PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS700A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS720A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS740A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents) |
CAS510A-KIT |
SBI |
1 Kit |
EUR 805 |
|
Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV200PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV205PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV220PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV225PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
CAS750A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
CAS770A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
CAS790A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Human zeta-associated protein 70 ELISA kit |
E01Z0037-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human zeta-associated protein 70 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human zeta-associated protein 70 ELISA kit |
E01Z0037-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human zeta-associated protein 70 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human zeta-associated protein 70 ELISA kit |
E01Z0037-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human zeta-associated protein 70 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Death Associated Protein 6 ELISA kit |
E01D0137-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Death Associated Protein 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Death Associated Protein 6 ELISA kit |
E01D0137-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Death Associated Protein 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Death Associated Protein 6 ELISA kit |
E01D0137-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Death Associated Protein 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human BCL2 Associated X Protein ELISA kit |
E01B0032-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human BCL2 Associated X Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human BCL2 Associated X Protein ELISA kit |
E01B0032-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human BCL2 Associated X Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human BCL2 Associated X Protein ELISA kit |
E01B0032-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human BCL2 Associated X Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human BRCA1 associated protein(BRAP) ELISA kit |
E01B0833-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human BRCA1 associated protein(BRAP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human PAEP(Progestagen Associated Endometrial Protein) ELISA Kit