Human SFN(Stratifin) ELISA Kit
Human Stratifin (SFN) ELISA Kit |
RD-SFN-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Stratifin (SFN) ELISA Kit |
RDR-SFN-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Stratifin (SFN) ELISA Kit |
RDR-SFN-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Stratifin (SFN)ELISA Kit |
201-12-2409 |
SunredBio |
96 tests |
EUR 440 |
- This Stratifin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Stratifin (SFN) ELISA Kit |
20-abx153184 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Stratifin ELISA Kit (SFN) |
RK02272 |
Abclonal |
96 Tests |
EUR 521 |
Human Stratifin (SFN) ELISA Kit |
SEH179Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stratifin (SFN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stratifin (SFN) in serum, plasma, cerebrospinal fluid and other biological fluids. |
Human Stratifin (SFN) ELISA Kit |
SEH179Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stratifin (SFN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stratifin (SFN) in serum, plasma, cerebrospinal fluid and other biological fluids. |
Human Stratifin (SFN) ELISA Kit |
SEH179Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stratifin (SFN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stratifin (SFN) in serum, plasma, cerebrospinal fluid and other biological fluids. |
Human Stratifin (SFN) ELISA Kit |
SEH179Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stratifin (SFN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stratifin (SFN) in serum, plasma, cerebrospinal fluid and other biological fluids. |
Human Stratifin (SFN) ELISA Kit |
4-SEH179Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Stratifin elisa. Alternative names of the recognized antigen: YWHAS
- HME1
- 14-3-3 Protein Sigma
- Epithelial cell marker protein 1
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Stratifin (SFN) in samples from Serum, plasma, cerebrospinal fluid and other biological fluids with no significant corss-reactivity with analogues from other species. |
Stratifin (SFN) Antibody |
20-abx100293 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Stratifin (SFN) Antibody |
20-abx100294 |
Abbexa |
-
EUR 439.00
-
EUR 133.00
-
EUR 1233.00
-
EUR 592.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Stratifin (SFN) Antibody |
20-abx115864 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Stratifin (SFN) Antibody |
20-abx174650 |
Abbexa |
|
|
|
Stratifin (SFN) Antibody |
20-abx338920 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Stratifin (SFN) Antibody |
20-abx325481 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Recombinant Stratifin (SFN) |
4-RPH179Hu01 |
Cloud-Clone |
-
EUR 368.80
-
EUR 202.00
-
EUR 1108.00
-
EUR 436.00
-
EUR 772.00
-
EUR 310.00
-
EUR 2620.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P31947
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 29.3kDa
- Isoelectric Point: 4.9
|
Description: Recombinant Human Stratifin expressed in: E.coli |
Recombinant Stratifin (SFN) |
4-RPH179Mu01 |
Cloud-Clone |
-
EUR 440.48
-
EUR 221.00
-
EUR 1376.80
-
EUR 525.60
-
EUR 951.20
-
EUR 358.00
-
EUR 3292.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: O70456
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 31.5kDa
- Isoelectric Point: 5.1
|
Description: Recombinant Mouse Stratifin expressed in: E.coli |
ELISA kit for Human SFN (Stratifin) |
ELK3118 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Stratifin (SFN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Stratifin (SFN). N
- Show more
|
Description: A sandwich ELISA kit for detection of Stratifin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Human Stratifin (SFN) CLIA Kit |
20-abx495400 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Human Stratifin (SFN) Protein |
abx060030-100ug |
Abbexa |
100 ug |
EUR 328 |
- Shipped within 5-10 working days.
|
Human Stratifin (SFN) Protein |
20-abx069174 |
Abbexa |
-
EUR 523.00
-
EUR 244.00
-
EUR 1497.00
-
EUR 606.00
-
EUR 384.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Mouse Stratifin (SFN) Protein |
20-abx069176 |
Abbexa |
-
EUR 620.00
-
EUR 272.00
-
EUR 1859.00
-
EUR 732.00
-
EUR 453.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Stratifin (SFN) Antibody (Biotin) |
20-abx272403 |
Abbexa |
-
EUR 453.00
-
EUR 244.00
-
EUR 1316.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Stratifin (SFN) Antibody (HRP) |
20-abx334440 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Stratifin (SFN) Antibody (FITC) |
20-abx334441 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Stratifin (SFN) Antibody (Biotin) |
20-abx334442 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Stratifin (SFN) Antibody (FITC) |
20-abx273571 |
Abbexa |
-
EUR 481.00
-
EUR 244.00
-
EUR 1414.00
-
EUR 662.00
-
EUR 356.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Stratifin (SFN) Polyclonal Antibody (Mouse) |
4-PAH179Mu01 |
Cloud-Clone |
-
EUR 251.00
-
EUR 2576.00
-
EUR 640.00
-
EUR 316.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SFN (Met1~Ser249)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Stratifin (SFN) |
Stratifin (SFN) Polyclonal Antibody (Human, Rat) |
4-PAH179Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SFN (Met1~Ser248)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Stratifin (SFN) |
Stratifin (SFN) Polyclonal Antibody (Human, Rat), APC |
4-PAH179Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SFN (Met1~Ser248)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Stratifin (SFN). This antibody is labeled with APC. |
Stratifin (SFN) Polyclonal Antibody (Human, Rat), Biotinylated |
4-PAH179Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SFN (Met1~Ser248)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Stratifin (SFN). This antibody is labeled with Biotin. |
Stratifin (SFN) Polyclonal Antibody (Human, Rat), Cy3 |
4-PAH179Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SFN (Met1~Ser248)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Stratifin (SFN). This antibody is labeled with Cy3. |
Stratifin (SFN) Polyclonal Antibody (Human, Rat), FITC |
4-PAH179Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SFN (Met1~Ser248)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Stratifin (SFN). This antibody is labeled with FITC. |
Stratifin (SFN) Polyclonal Antibody (Human, Rat), HRP |
4-PAH179Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SFN (Met1~Ser248)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Stratifin (SFN). This antibody is labeled with HRP. |
Stratifin (SFN) Polyclonal Antibody (Human, Rat), PE |
4-PAH179Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SFN (Met1~Ser248)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Stratifin (SFN). This antibody is labeled with PE. |
Stratifin (SFN) Polyclonal Antibody (Mouse), APC |
4-PAH179Mu01-APC |
Cloud-Clone |
-
EUR 351.00
-
EUR 3365.00
-
EUR 935.00
-
EUR 449.00
-
EUR 222.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SFN (Met1~Ser249)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Stratifin (SFN). This antibody is labeled with APC. |
Stratifin (SFN) Polyclonal Antibody (Mouse), Biotinylated |
4-PAH179Mu01-Biotin |
Cloud-Clone |
-
EUR 316.00
-
EUR 2526.00
-
EUR 744.00
-
EUR 387.00
-
EUR 221.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SFN (Met1~Ser249)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Stratifin (SFN). This antibody is labeled with Biotin. |
Stratifin (SFN) Polyclonal Antibody (Mouse), Cy3 |
4-PAH179Mu01-Cy3 |
Cloud-Clone |
-
EUR 427.00
-
EUR 4445.00
-
EUR 1205.00
-
EUR 557.00
-
EUR 254.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SFN (Met1~Ser249)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Stratifin (SFN). This antibody is labeled with Cy3. |
Stratifin (SFN) Polyclonal Antibody (Mouse), FITC |
4-PAH179Mu01-FITC |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SFN (Met1~Ser249)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Stratifin (SFN). This antibody is labeled with FITC. |
Stratifin (SFN) Polyclonal Antibody (Mouse), HRP |
4-PAH179Mu01-HRP |
Cloud-Clone |
-
EUR 321.00
-
EUR 2933.00
-
EUR 827.00
-
EUR 405.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SFN (Met1~Ser249)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Stratifin (SFN). This antibody is labeled with HRP. |
Stratifin (SFN) Polyclonal Antibody (Mouse), PE |
4-PAH179Mu01-PE |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SFN (Met1~Ser249)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Stratifin (SFN). This antibody is labeled with PE. |
Stratifin (SFN) Polyclonal Antibody (Human, Rat), APC-Cy7 |
4-PAH179Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SFN (Met1~Ser248)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Stratifin (SFN). This antibody is labeled with APC-Cy7. |
Stratifin (SFN) Polyclonal Antibody (Mouse), APC-Cy7 |
4-PAH179Mu01-APC-Cy7 |
Cloud-Clone |
-
EUR 583.00
-
EUR 6610.00
-
EUR 1750.00
-
EUR 778.00
-
EUR 324.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SFN (Met1~Ser249)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Stratifin (SFN). This antibody is labeled with APC-Cy7. |
Polyclonal SFN / Stratifin / 14-3-3 Sigma Antibody (Internal) |
APR13298G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human SFN / Stratifin / 14-3-3 Sigma (Internal). This antibody is tested and proven to work in the following applications: |
Polyclonal SFN / Stratifin / 14-3-3 Sigma Antibody (aa120-170) |
APR13296G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SFN / Stratifin / 14-3-3 Sigma (aa120-170). This antibody is tested and proven to work in the following applications: |
Polyclonal SFN / Stratifin / 14-3-3 Sigma Antibody (N-Terminus) |
APR13299G |
Leading Biology |
0.05ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SFN / Stratifin / 14-3-3 Sigma (N-Terminus). This antibody is tested and proven to work in the following applications: |
Monoclonal SFN / Stratifin / 14-3-3 Sigma Antibody (clone 3C3), Clone: 3C3 |
APR13297G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A Monoclonal antibody against Human SFN / Stratifin / 14-3-3 Sigma (clone 3C3). The antibodies are raised in Mouse and are from clone 3C3. This antibody is applicable in WB and IHC-P |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
Stratifin Antibody (Biotin) |
abx430936-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
SFN antibody |
70R-20201 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal SFN antibody |
SFN antibody |
70R-14334 |
Fitzgerald |
100 ug |
EUR 322 |
Description: Affinity purified Rabbit polyclonal SFN antibody |
SFN Antibody |
32126-100ul |
SAB |
100ul |
EUR 252 |
SFN Antibody |
43001-100ul |
SAB |
100ul |
EUR 252 |
SFN Antibody |
DF6189 |
Affbiotech |
200ul |
EUR 304 |
Description: SFN Antibody detects endogenous levels of total SFN. |
SFN antibody |
70R-9288 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal SFN antibody |
SFN antibody |
70R-5570 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal SFN antibody raised against the middle region of SFN |
SFN Antibody |
1-CSB-PA008892 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against SFN. Recognizes SFN from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000 |
SFN Antibody |
1-CSB-PA021135GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20oC, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against SFN. Recognizes SFN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA |
SFN Antibody |
1-CSB-PA021135LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against SFN. Recognizes SFN from Human, Rat, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:500-1:1000, IF:1:200-1:500 |
SFN siRNA |
20-abx933104 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SFN siRNA |
20-abx933105 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Human SFN shRNA Plasmid |
20-abx951877 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
SFN Recombinant Protein (Human) |
RP028300 |
ABM |
100 ug |
Ask for price |
SFN Recombinant Protein (Human) |
RP028303 |
ABM |
100 ug |
Ask for price |
Human 14-3-3 protein sigma(SFN) ELISA kit |
CSB-EL021135HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human 14-3-3 protein sigma (SFN) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human 14-3-3 protein sigma(SFN) ELISA kit |
1-CSB-EL021135HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human 14-3-3 protein sigma(SFN) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human 14-3-3 protein sigma(SFN) ELISA kit |
E01P0214-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human 14-3-3 protein sigma(SFN) ELISA kit |
E01P0214-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human 14-3-3 protein sigma(SFN) ELISA kit |
E01P0214-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human 14-3-3 protein sigma (SFN) ELISA Kit |
abx251077-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
Human SFN/ 14-3-3 protein sigma ELISA Kit |
E2271Hu |
Sunlong |
1 Kit |
EUR 605 |
Human SFN(14-3-3 protein sigma) ELISA Kit |
EH1771 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 78-5000 pg/ml
- Uniprot ID: P31947
- Alias: SFN/14-3-3 protein sigma/Epithelial cell marker protein 1/Stratifin/HME1/YWHAS
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9pg/ml |
SFN Rabbit pAb |
A1026-100ul |
Abclonal |
100 ul |
EUR 308 |
SFN Rabbit pAb |
A1026-200ul |
Abclonal |
200 ul |
EUR 459 |
SFN Rabbit pAb |
A1026-20ul |
Abclonal |
20 ul |
EUR 183 |
SFN Rabbit pAb |
A1026-50ul |
Abclonal |
50 ul |
EUR 223 |
SFN Blocking Peptide |
33R-2923 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SFN antibody, catalog no. 70R-5570 |
SFN Blocking Peptide |
33R-9879 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SFN antibody, catalog no. 70R-9288 |
SFN Blocking Peptide |
DF6189-BP |
Affbiotech |
1mg |
EUR 195 |
SFN Polyclonal Antibody |
A-2745 |
EpiGentek |
100 µl |
EUR 483.55 |
Description: kits suitable for this type of research |
SFN Conjugated Antibody |
C32126 |
SAB |
100ul |
EUR 397 |
SFN cloning plasmid |
CSB-CL021135HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 747
- Sequence: atggagagagccagtctgatccagaaggccaagctggcagagcaggccgaacgctatgaggacatggcagccttcatgaaaggcgccgtggagaagggcgaggagctctcctgcgaagagcgaaacctgctctcagtagcctataagaacgtggtgggcggccagagggctgcctg
- Show more
|
Description: A cloning plasmid for the SFN gene. |
SFN cloning plasmid |
CSB-CL021135HU2-10ug |
Cusabio |
10ug |
EUR 292 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 651
- Sequence: atggagagagccagtctgatccagaaggccaagctggcagagcaggccgaacgctatgaggacatggcagccttcatgaaaggcgccgtggagaagggcgaggagctctcctgcgaagagcgaaacctgctctcagtagcctataagaacgtggtgggcggccagagggctgcctg
- Show more
|
Description: A cloning plasmid for the SFN gene. |
anti- SFN antibody |
FNab09897 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500 - 1:2000
- IHC: 1:50 - 1:200
- IF: 1:50 - 1:100
- Immunogen: 14-3-3 protein sigma
- Uniprot ID: P31947
- Gene ID: 2810
- Research Area: Neuroscience, Signal Transduction
|
Description: Antibody raised against SFN |
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
SFN ORF Vector (Human) (pORF) |
ORF009434 |
ABM |
1.0 ug DNA |
EUR 95 |
SFN ORF Vector (Human) (pORF) |
ORF009435 |
ABM |
1.0 ug DNA |
EUR 95 |
Column Packing Kit |
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
PCR Mycoplasma Detection Kit |
M034-Kit |
TOKU-E |
Kit |
EUR 266 |
ELISA kit for Human 14-3-3 protein sigma (SFN) |
KTE60683-48T |
Abbkine |
48T |
EUR 332 |
- Stratifin, was shown to be diffusely distributed in the cytoplasm and was present in cultured epithelial cells. It was most abundant in tissues enriched in stratified keratinizing epithelium.The induction of 14-3-3-sigma is mediated by a p53 -respons
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human 14-3-3 protein sigma (SFN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human 14-3-3 protein sigma (SFN) |
KTE60683-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Stratifin, was shown to be diffusely distributed in the cytoplasm and was present in cultured epithelial cells. It was most abundant in tissues enriched in stratified keratinizing epithelium.The induction of 14-3-3-sigma is mediated by a p53 -respons
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human 14-3-3 protein sigma (SFN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human 14-3-3 protein sigma (SFN) |
KTE60683-96T |
Abbkine |
96T |
EUR 539 |
- Stratifin, was shown to be diffusely distributed in the cytoplasm and was present in cultured epithelial cells. It was most abundant in tissues enriched in stratified keratinizing epithelium.The induction of 14-3-3-sigma is mediated by a p53 -respons
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human 14-3-3 protein sigma (SFN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit |
CAS400A-KIT |
SBI |
1 kit (10 rxn) |
EUR 1110 |
|
Polyclonal SFN Antibody (Center) |
APR17857G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SFN (Center). This antibody is tested and proven to work in the following applications: |
Mouse SFN shRNA Plasmid |
20-abx974565 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Polyclonal SFN Antibody (Center) |
APR13281G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SFN (Center). This antibody is tested and proven to work in the following applications: |
SFN Antibody, HRP conjugated |
1-CSB-PA021135LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against SFN. Recognizes SFN from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
SFN Antibody, FITC conjugated |
1-CSB-PA021135LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against SFN. Recognizes SFN from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
SFN Antibody, Biotin conjugated |
1-CSB-PA021135LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against SFN. Recognizes SFN from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
SFN Recombinant Protein (Mouse) |
RP171359 |
ABM |
100 ug |
Ask for price |
SFN sgRNA CRISPR Lentivector set (Human) |
K2131401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Rat 14-3-3 protein sigma(SFN) ELISA kit |
E02P0214-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat 14-3-3 protein sigma(SFN) ELISA kit |
E02P0214-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat 14-3-3 protein sigma(SFN) ELISA kit |
E02P0214-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit 14-3-3 protein sigma(SFN) ELISA kit |
E04P0214-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit 14-3-3 protein sigma(SFN) ELISA kit |
E04P0214-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit 14-3-3 protein sigma(SFN) ELISA kit |
E04P0214-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse 14-3-3 protein sigma(SFN) ELISA kit |
E03P0214-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse 14-3-3 protein sigma(SFN) ELISA kit |
E03P0214-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human SFN(Stratifin) ELISA Kit