Human SFN(Stratifin) ELISA Kit

Human SFN(Stratifin) ELISA Kit

Human Stratifin (SFN) ELISA Kit

RD-SFN-Hu-96Tests 96 Tests
EUR 723

Human Stratifin (SFN) ELISA Kit

RDR-SFN-Hu-48Tests 48 Tests
EUR 544

Human Stratifin (SFN) ELISA Kit

RDR-SFN-Hu-96Tests 96 Tests
EUR 756

Human Stratifin (SFN)ELISA Kit

201-12-2409 96 tests
EUR 440
  • This Stratifin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Stratifin (SFN) ELISA Kit

20-abx153184
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human SFN (Stratifin) ELISA KIT

ELI-49767h 96 Tests
EUR 824

Human Stratifin(SFN)ELISA Kit

QY-E03598 96T
EUR 361

Human Stratifin ELISA Kit (SFN)

RK02272 96 Tests
EUR 521

Human Stratifin (SFN) ELISA Kit

SEH179Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stratifin (SFN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stratifin (SFN) in serum, plasma, cerebrospinal fluid and other biological fluids.

Human Stratifin (SFN) ELISA Kit

SEH179Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stratifin (SFN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stratifin (SFN) in serum, plasma, cerebrospinal fluid and other biological fluids.

Human Stratifin (SFN) ELISA Kit

SEH179Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stratifin (SFN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stratifin (SFN) in serum, plasma, cerebrospinal fluid and other biological fluids.

Human Stratifin (SFN) ELISA Kit

SEH179Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stratifin (SFN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stratifin (SFN) in serum, plasma, cerebrospinal fluid and other biological fluids.

Human Stratifin (SFN) ELISA Kit

4-SEH179Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Stratifin elisa. Alternative names of the recognized antigen: YWHAS
  • HME1
  • 14-3-3 Protein Sigma
  • Epithelial cell marker protein 1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Stratifin (SFN) in samples from Serum, plasma, cerebrospinal fluid and other biological fluids with no significant corss-reactivity with analogues from other species.

Bovine SFN (Stratifin) ELISA KIT

ELI-49743b 96 Tests
EUR 928

Mouse SFN (Stratifin) ELISA KIT

ELI-49744m 96 Tests
EUR 865

Rat StRatifin(SFN)ELISA Kit

QY-E10473 96T
EUR 361

Stratifin (SFN) Antibody

20-abx100293
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Stratifin (SFN) Antibody

20-abx100294
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Stratifin (SFN) Antibody

20-abx115864
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Stratifin (SFN) Antibody

20-abx174650
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Stratifin (SFN) Antibody

20-abx338920
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Stratifin (SFN) Antibody

20-abx325481
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Recombinant Stratifin (SFN)

4-RPH179Hu01
  • EUR 368.80
  • EUR 202.00
  • EUR 1108.00
  • EUR 436.00
  • EUR 772.00
  • EUR 310.00
  • EUR 2620.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P31947
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 29.3kDa
  • Isoelectric Point: 4.9
Description: Recombinant Human Stratifin expressed in: E.coli

Recombinant Stratifin (SFN)

4-RPH179Mu01
  • EUR 440.48
  • EUR 221.00
  • EUR 1376.80
  • EUR 525.60
  • EUR 951.20
  • EUR 358.00
  • EUR 3292.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O70456
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 31.5kDa
  • Isoelectric Point: 5.1
Description: Recombinant Mouse Stratifin expressed in: E.coli

ELISA kit for Human SFN (Stratifin)

ELK3118 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Stratifin (SFN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Stratifin (SFN). N
  • Show more
Description: A sandwich ELISA kit for detection of Stratifin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Stratifin (SFN) CLIA Kit

20-abx495400
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Stratifin (SFN) Protein

abx060030-100ug 100 ug
EUR 328
  • Shipped within 5-10 working days.

Human Stratifin (SFN) Protein

20-abx069174
  • EUR 523.00
  • EUR 244.00
  • EUR 1497.00
  • EUR 606.00
  • EUR 384.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Mouse Stratifin (SFN) Protein

20-abx069176
  • EUR 620.00
  • EUR 272.00
  • EUR 1859.00
  • EUR 732.00
  • EUR 453.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Stratifin (SFN) Antibody (Biotin)

20-abx272403
  • EUR 453.00
  • EUR 244.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Stratifin (SFN) Antibody (HRP)

20-abx334440
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Stratifin (SFN) Antibody (FITC)

20-abx334441
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Stratifin (SFN) Antibody (Biotin)

20-abx334442
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Stratifin (SFN) Antibody (FITC)

20-abx273571
  • EUR 481.00
  • EUR 244.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Stratifin (SFN) Polyclonal Antibody (Mouse)

4-PAH179Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SFN (Met1~Ser249)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Stratifin (SFN)

Stratifin (SFN) Polyclonal Antibody (Human, Rat)

4-PAH179Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SFN (Met1~Ser248)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Stratifin (SFN)

Stratifin (SFN) Polyclonal Antibody (Human, Rat), APC

4-PAH179Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SFN (Met1~Ser248)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Stratifin (SFN). This antibody is labeled with APC.

Stratifin (SFN) Polyclonal Antibody (Human, Rat), Biotinylated

4-PAH179Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SFN (Met1~Ser248)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Stratifin (SFN). This antibody is labeled with Biotin.

Stratifin (SFN) Polyclonal Antibody (Human, Rat), Cy3

4-PAH179Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SFN (Met1~Ser248)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Stratifin (SFN). This antibody is labeled with Cy3.

Stratifin (SFN) Polyclonal Antibody (Human, Rat), FITC

4-PAH179Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SFN (Met1~Ser248)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Stratifin (SFN). This antibody is labeled with FITC.

Stratifin (SFN) Polyclonal Antibody (Human, Rat), HRP

4-PAH179Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SFN (Met1~Ser248)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Stratifin (SFN). This antibody is labeled with HRP.

Stratifin (SFN) Polyclonal Antibody (Human, Rat), PE

4-PAH179Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SFN (Met1~Ser248)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Stratifin (SFN). This antibody is labeled with PE.

Stratifin (SFN) Polyclonal Antibody (Mouse), APC

4-PAH179Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SFN (Met1~Ser249)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Stratifin (SFN). This antibody is labeled with APC.

Stratifin (SFN) Polyclonal Antibody (Mouse), Biotinylated

4-PAH179Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SFN (Met1~Ser249)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Stratifin (SFN). This antibody is labeled with Biotin.

Stratifin (SFN) Polyclonal Antibody (Mouse), Cy3

4-PAH179Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SFN (Met1~Ser249)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Stratifin (SFN). This antibody is labeled with Cy3.

Stratifin (SFN) Polyclonal Antibody (Mouse), FITC

4-PAH179Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SFN (Met1~Ser249)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Stratifin (SFN). This antibody is labeled with FITC.

Stratifin (SFN) Polyclonal Antibody (Mouse), HRP

4-PAH179Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SFN (Met1~Ser249)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Stratifin (SFN). This antibody is labeled with HRP.

Stratifin (SFN) Polyclonal Antibody (Mouse), PE

4-PAH179Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SFN (Met1~Ser249)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Stratifin (SFN). This antibody is labeled with PE.

Stratifin (SFN) Polyclonal Antibody (Human, Rat), APC-Cy7

4-PAH179Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SFN (Met1~Ser248)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Stratifin (SFN). This antibody is labeled with APC-Cy7.

Stratifin (SFN) Polyclonal Antibody (Mouse), APC-Cy7

4-PAH179Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SFN (Met1~Ser249)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Stratifin (SFN). This antibody is labeled with APC-Cy7.

Polyclonal SFN / Stratifin / 14-3-3 Sigma Antibody (Internal)

APR13298G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human SFN / Stratifin / 14-3-3 Sigma (Internal). This antibody is tested and proven to work in the following applications:

Human SFN ELISA Kit

ELA-E15106h 96 Tests
EUR 824

SFN ELISA KIT|Human

EF005907 96 Tests
EUR 689

Polyclonal SFN / Stratifin / 14-3-3 Sigma Antibody (aa120-170)

APR13296G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SFN / Stratifin / 14-3-3 Sigma (aa120-170). This antibody is tested and proven to work in the following applications:

Polyclonal SFN / Stratifin / 14-3-3 Sigma Antibody (N-Terminus)

APR13299G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SFN / Stratifin / 14-3-3 Sigma (N-Terminus). This antibody is tested and proven to work in the following applications:

Monoclonal SFN / Stratifin / 14-3-3 Sigma Antibody (clone 3C3), Clone: 3C3

APR13297G 0.05mg
EUR 528
Description: A Monoclonal antibody against Human SFN / Stratifin / 14-3-3 Sigma (clone 3C3). The antibodies are raised in Mouse and are from clone 3C3. This antibody is applicable in WB and IHC-P

SFN

E541-319 100ug
EUR 343

Mouse StMouseifin(SFN)ELISA Kit

QY-E21402 96T
EUR 361

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

Stratifin Antibody (Biotin)

abx430936-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

SFN antibody

70R-20201 50 ul
EUR 435
Description: Rabbit polyclonal SFN antibody

SFN antibody

70R-14334 100 ug
EUR 322
Description: Affinity purified Rabbit polyclonal SFN antibody

SFN Antibody

32126-100ul 100ul
EUR 252

SFN Antibody

43001-100ul 100ul
EUR 252

SFN Antibody

DF6189 200ul
EUR 304
Description: SFN Antibody detects endogenous levels of total SFN.

SFN antibody

70R-9288 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal SFN antibody

SFN antibody

70R-5570 50 ug
EUR 467
Description: Rabbit polyclonal SFN antibody raised against the middle region of SFN

SFN Antibody

1-CSB-PA008892
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against SFN. Recognizes SFN from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

SFN Antibody

1-CSB-PA021135GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20oC, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against SFN. Recognizes SFN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA

SFN Antibody

1-CSB-PA021135LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SFN. Recognizes SFN from Human, Rat, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:500-1:1000, IF:1:200-1:500

SFN siRNA

20-abx933104
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SFN siRNA

20-abx933105
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SFN Antibody

ABD6189 100 ug
EUR 438

SFN antibody

PAab09897 100 ug
EUR 386

pOTB7-SFN

PVT18303 2 ug
EUR 231

Human SFN shRNA Plasmid

20-abx951877
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SFN Recombinant Protein (Human)

RP028300 100 ug Ask for price

SFN Recombinant Protein (Human)

RP028303 100 ug Ask for price

Human 14-3-3 protein sigma(SFN) ELISA kit

CSB-EL021135HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human 14-3-3 protein sigma (SFN) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human 14-3-3 protein sigma(SFN) ELISA kit

1-CSB-EL021135HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human 14-3-3 protein sigma(SFN) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human 14-3-3 protein sigma(SFN) ELISA kit

E01P0214-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human 14-3-3 protein sigma(SFN) ELISA kit

E01P0214-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human 14-3-3 protein sigma(SFN) ELISA kit

E01P0214-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human 14-3-3 protein sigma (SFN) ELISA Kit

abx251077-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Human SFN/ 14-3-3 protein sigma ELISA Kit

E2271Hu 1 Kit
EUR 605

Human SFN(14-3-3 protein sigma) ELISA Kit

EH1771 96T
EUR 567.6
  • Detection range: 78-5000 pg/ml
  • Uniprot ID: P31947
  • Alias: SFN/14-3-3 protein sigma/Epithelial cell marker protein 1/Stratifin/HME1/YWHAS
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9pg/ml

SFN Rabbit pAb

A1026-100ul 100 ul
EUR 308

SFN Rabbit pAb

A1026-200ul 200 ul
EUR 459

SFN Rabbit pAb

A1026-20ul 20 ul
EUR 183

SFN Rabbit pAb

A1026-50ul 50 ul
EUR 223

SFN Blocking Peptide

33R-2923 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SFN antibody, catalog no. 70R-5570

SFN Blocking Peptide

33R-9879 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SFN antibody, catalog no. 70R-9288

SFN Blocking Peptide

DF6189-BP 1mg
EUR 195

SFN Polyclonal Antibody

A-2745 100 µl
EUR 483.55
Description: kits suitable for this type of research

SFN Conjugated Antibody

C32126 100ul
EUR 397

SFN cloning plasmid

CSB-CL021135HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 747
  • Sequence: atggagagagccagtctgatccagaaggccaagctggcagagcaggccgaacgctatgaggacatggcagccttcatgaaaggcgccgtggagaagggcgaggagctctcctgcgaagagcgaaacctgctctcagtagcctataagaacgtggtgggcggccagagggctgcctg
  • Show more
Description: A cloning plasmid for the SFN gene.

SFN cloning plasmid

CSB-CL021135HU2-10ug 10ug
EUR 292
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 651
  • Sequence: atggagagagccagtctgatccagaaggccaagctggcagagcaggccgaacgctatgaggacatggcagccttcatgaaaggcgccgtggagaagggcgaggagctctcctgcgaagagcgaaacctgctctcagtagcctataagaacgtggtgggcggccagagggctgcctg
  • Show more
Description: A cloning plasmid for the SFN gene.

anti- SFN antibody

FNab09897 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:100
  • Immunogen: 14-3-3 protein sigma
  • Uniprot ID: P31947
  • Gene ID: 2810
  • Research Area: Neuroscience, Signal Transduction
Description: Antibody raised against SFN

anti- SFN antibody

LSMab09897 100 ug
EUR 386

pCMV-SPORT6-SFN

PVT13720 2 ug
EUR 391

Anti-SFN antibody

STJ25500 100 µl
EUR 277

Anti-SFN antibody

STJ119984 100 µl
EUR 413

Anti-SFN Antibody

STJ502960 100 µg
EUR 476

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

SFN ORF Vector (Human) (pORF)

ORF009434 1.0 ug DNA
EUR 95

SFN ORF Vector (Human) (pORF)

ORF009435 1.0 ug DNA
EUR 95

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

ELISA kit for Human 14-3-3 protein sigma (SFN)

KTE60683-48T 48T
EUR 332
  • Stratifin, was shown to be diffusely distributed in the cytoplasm and was present in cultured epithelial cells. It was most abundant in tissues enriched in stratified keratinizing epithelium.The induction of 14-3-3-sigma is mediated by a p53 -respons
  • Show more
Description: Quantitative sandwich ELISA for measuring Human 14-3-3 protein sigma (SFN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human 14-3-3 protein sigma (SFN)

KTE60683-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Stratifin, was shown to be diffusely distributed in the cytoplasm and was present in cultured epithelial cells. It was most abundant in tissues enriched in stratified keratinizing epithelium.The induction of 14-3-3-sigma is mediated by a p53 -respons
  • Show more
Description: Quantitative sandwich ELISA for measuring Human 14-3-3 protein sigma (SFN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human 14-3-3 protein sigma (SFN)

KTE60683-96T 96T
EUR 539
  • Stratifin, was shown to be diffusely distributed in the cytoplasm and was present in cultured epithelial cells. It was most abundant in tissues enriched in stratified keratinizing epithelium.The induction of 14-3-3-sigma is mediated by a p53 -respons
  • Show more
Description: Quantitative sandwich ELISA for measuring Human 14-3-3 protein sigma (SFN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

Polyclonal SFN Antibody (Center)

APR17857G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SFN (Center). This antibody is tested and proven to work in the following applications:

Mouse SFN shRNA Plasmid

20-abx974565
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Polyclonal SFN Antibody (Center)

APR13281G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SFN (Center). This antibody is tested and proven to work in the following applications:

SFN Antibody, HRP conjugated

1-CSB-PA021135LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SFN. Recognizes SFN from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SFN Antibody, FITC conjugated

1-CSB-PA021135LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SFN. Recognizes SFN from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SFN Antibody, Biotin conjugated

1-CSB-PA021135LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SFN. Recognizes SFN from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

SFN Recombinant Protein (Mouse)

RP171359 100 ug Ask for price

Anti-SFN Antibody (Biotin)

STJ502961 100 µg
EUR 586

Anti-SFN Antibody (FITC)

STJ502962 100 µg
EUR 586

SFN sgRNA CRISPR Lentivector set (Human)

K2131401 3 x 1.0 ug
EUR 339

Rat 14-3-3 protein sigma(SFN) ELISA kit

E02P0214-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat 14-3-3 protein sigma(SFN) ELISA kit

E02P0214-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat 14-3-3 protein sigma(SFN) ELISA kit

E02P0214-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit 14-3-3 protein sigma(SFN) ELISA kit

E04P0214-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit 14-3-3 protein sigma(SFN) ELISA kit

E04P0214-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit 14-3-3 protein sigma(SFN) ELISA kit

E04P0214-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse 14-3-3 protein sigma(SFN) ELISA kit

E03P0214-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse 14-3-3 protein sigma(SFN) ELISA kit

E03P0214-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human SFN(Stratifin) ELISA Kit