Human SFN(Stratifin) ELISA Kit
Human Stratifin (SFN) ELISA Kit |
RD-SFN-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Stratifin (SFN) ELISA Kit |
RDR-SFN-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Stratifin (SFN) ELISA Kit |
RDR-SFN-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Stratifin (SFN) ELISA Kit |
20-abx153184 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Stratifin (SFN)ELISA Kit |
201-12-2409 |
SunredBio |
96 tests |
EUR 440 |
- This Stratifin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Stratifin ELISA Kit (SFN) |
RK02272 |
Abclonal |
96 Tests |
EUR 521 |
Human Stratifin (SFN) ELISA Kit |
SEH179Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stratifin (SFN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stratifin (SFN) in serum, plasma, cerebrospinal fluid and other biological fluids. |
Human Stratifin (SFN) ELISA Kit |
SEH179Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stratifin (SFN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stratifin (SFN) in serum, plasma, cerebrospinal fluid and other biological fluids. |
Human Stratifin (SFN) ELISA Kit |
SEH179Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stratifin (SFN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stratifin (SFN) in serum, plasma, cerebrospinal fluid and other biological fluids. |
Human Stratifin (SFN) ELISA Kit |
SEH179Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stratifin (SFN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stratifin (SFN) in serum, plasma, cerebrospinal fluid and other biological fluids. |
Human Stratifin (SFN) ELISA Kit |
4-SEH179Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Stratifin elisa. Alternative names of the recognized antigen: YWHAS
- HME1
- 14-3-3 Protein Sigma
- Epithelial cell marker protein 1
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Stratifin (SFN) in samples from Serum, plasma, cerebrospinal fluid and other biological fluids with no significant corss-reactivity with analogues from other species. |
Stratifin (SFN) Antibody |
20-abx115864 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Stratifin (SFN) Antibody |
20-abx100293 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Stratifin (SFN) Antibody |
20-abx100294 |
Abbexa |
-
EUR 439.00
-
EUR 133.00
-
EUR 1233.00
-
EUR 592.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Stratifin (SFN) Antibody |
20-abx174650 |
Abbexa |
|
|
|
Stratifin (SFN) Antibody |
20-abx325481 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Stratifin (SFN) Antibody |
20-abx338920 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Recombinant Stratifin (SFN) |
4-RPH179Hu01 |
Cloud-Clone |
-
EUR 368.80
-
EUR 202.00
-
EUR 1108.00
-
EUR 436.00
-
EUR 772.00
-
EUR 310.00
-
EUR 2620.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P31947
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 29.3kDa
- Isoelectric Point: 4.9
|
Description: Recombinant Human Stratifin expressed in: E.coli |
Recombinant Stratifin (SFN) |
4-RPH179Mu01 |
Cloud-Clone |
-
EUR 440.48
-
EUR 221.00
-
EUR 1376.80
-
EUR 525.60
-
EUR 951.20
-
EUR 358.00
-
EUR 3292.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: O70456
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 31.5kDa
- Isoelectric Point: 5.1
|
Description: Recombinant Mouse Stratifin expressed in: E.coli |
ELISA kit for Human SFN (Stratifin) |
ELK3118 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Stratifin (SFN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Stratifin (SFN). N
- Show more
|
Description: A sandwich ELISA kit for detection of Stratifin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Human Stratifin (SFN) CLIA Kit |
20-abx495400 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Human Stratifin (SFN) Protein |
20-abx069174 |
Abbexa |
-
EUR 523.00
-
EUR 244.00
-
EUR 1497.00
-
EUR 606.00
-
EUR 384.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Human Stratifin (SFN) Protein |
abx060030-100ug |
Abbexa |
100 ug |
EUR 328 |
- Shipped within 5-10 working days.
|
Mouse Stratifin (SFN) Protein |
20-abx069176 |
Abbexa |
-
EUR 620.00
-
EUR 272.00
-
EUR 1859.00
-
EUR 732.00
-
EUR 453.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Stratifin (SFN) Antibody (FITC) |
20-abx273571 |
Abbexa |
-
EUR 481.00
-
EUR 244.00
-
EUR 1414.00
-
EUR 662.00
-
EUR 356.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Stratifin (SFN) Antibody (HRP) |
20-abx334440 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Stratifin (SFN) Antibody (FITC) |
20-abx334441 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Stratifin (SFN) Antibody (Biotin) |
20-abx334442 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Stratifin (SFN) Antibody (Biotin) |
20-abx272403 |
Abbexa |
-
EUR 453.00
-
EUR 244.00
-
EUR 1316.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Stratifin (SFN) Polyclonal Antibody (Mouse) |
4-PAH179Mu01 |
Cloud-Clone |
-
EUR 251.00
-
EUR 2576.00
-
EUR 640.00
-
EUR 316.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SFN (Met1~Ser249)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Stratifin (SFN) |
Stratifin (SFN) Polyclonal Antibody (Human, Rat) |
4-PAH179Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SFN (Met1~Ser248)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Stratifin (SFN) |
Stratifin (SFN) Polyclonal Antibody (Human, Rat), APC |
4-PAH179Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SFN (Met1~Ser248)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Stratifin (SFN). This antibody is labeled with APC. |
Stratifin (SFN) Polyclonal Antibody (Human, Rat), Biotinylated |
4-PAH179Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SFN (Met1~Ser248)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Stratifin (SFN). This antibody is labeled with Biotin. |
Stratifin (SFN) Polyclonal Antibody (Human, Rat), Cy3 |
4-PAH179Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SFN (Met1~Ser248)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Stratifin (SFN). This antibody is labeled with Cy3. |
Stratifin (SFN) Polyclonal Antibody (Human, Rat), FITC |
4-PAH179Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SFN (Met1~Ser248)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Stratifin (SFN). This antibody is labeled with FITC. |
Stratifin (SFN) Polyclonal Antibody (Human, Rat), HRP |
4-PAH179Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SFN (Met1~Ser248)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Stratifin (SFN). This antibody is labeled with HRP. |
Stratifin (SFN) Polyclonal Antibody (Human, Rat), PE |
4-PAH179Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SFN (Met1~Ser248)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Stratifin (SFN). This antibody is labeled with PE. |
Stratifin (SFN) Polyclonal Antibody (Mouse), APC |
4-PAH179Mu01-APC |
Cloud-Clone |
-
EUR 351.00
-
EUR 3365.00
-
EUR 935.00
-
EUR 449.00
-
EUR 222.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SFN (Met1~Ser249)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Stratifin (SFN). This antibody is labeled with APC. |
Stratifin (SFN) Polyclonal Antibody (Mouse), Biotinylated |
4-PAH179Mu01-Biotin |
Cloud-Clone |
-
EUR 316.00
-
EUR 2526.00
-
EUR 744.00
-
EUR 387.00
-
EUR 221.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SFN (Met1~Ser249)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Stratifin (SFN). This antibody is labeled with Biotin. |
Stratifin (SFN) Polyclonal Antibody (Mouse), Cy3 |
4-PAH179Mu01-Cy3 |
Cloud-Clone |
-
EUR 427.00
-
EUR 4445.00
-
EUR 1205.00
-
EUR 557.00
-
EUR 254.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SFN (Met1~Ser249)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Stratifin (SFN). This antibody is labeled with Cy3. |
Stratifin (SFN) Polyclonal Antibody (Mouse), FITC |
4-PAH179Mu01-FITC |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SFN (Met1~Ser249)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Stratifin (SFN). This antibody is labeled with FITC. |
Stratifin (SFN) Polyclonal Antibody (Mouse), HRP |
4-PAH179Mu01-HRP |
Cloud-Clone |
-
EUR 321.00
-
EUR 2933.00
-
EUR 827.00
-
EUR 405.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SFN (Met1~Ser249)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Stratifin (SFN). This antibody is labeled with HRP. |
Stratifin (SFN) Polyclonal Antibody (Mouse), PE |
4-PAH179Mu01-PE |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SFN (Met1~Ser249)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Stratifin (SFN). This antibody is labeled with PE. |
Stratifin (SFN) Polyclonal Antibody (Human, Rat), APC-Cy7 |
4-PAH179Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SFN (Met1~Ser248)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Stratifin (SFN). This antibody is labeled with APC-Cy7. |
Stratifin (SFN) Polyclonal Antibody (Mouse), APC-Cy7 |
4-PAH179Mu01-APC-Cy7 |
Cloud-Clone |
-
EUR 583.00
-
EUR 6610.00
-
EUR 1750.00
-
EUR 778.00
-
EUR 324.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SFN (Met1~Ser249)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Stratifin (SFN). This antibody is labeled with APC-Cy7. |
Polyclonal SFN / Stratifin / 14-3-3 Sigma Antibody (Internal) |
APR13298G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human SFN / Stratifin / 14-3-3 Sigma (Internal). This antibody is tested and proven to work in the following applications: |
Polyclonal SFN / Stratifin / 14-3-3 Sigma Antibody (aa120-170) |
APR13296G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SFN / Stratifin / 14-3-3 Sigma (aa120-170). This antibody is tested and proven to work in the following applications: |
Polyclonal SFN / Stratifin / 14-3-3 Sigma Antibody (N-Terminus) |
APR13299G |
Leading Biology |
0.05ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SFN / Stratifin / 14-3-3 Sigma (N-Terminus). This antibody is tested and proven to work in the following applications: |
SFN ELISA Kit (Human) (OKAN06228) |
OKAN06228 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: This gene encodes a cell cycle checkpoint protein. The encoded protein binds to translation and initiation factors and functions as a regulator of mitotic translation. In response to DNA damage this protein plays a role in preventing DNA errors during mitosis.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 11.9 pg/mL |
SFN ELISA Kit (Human) (OKCD09035) |
OKCD09035 |
Aviva Systems Biology |
96 Wells |
EUR 975 |
Description: Description of target: SFN is an adapter protein implicated in the regulation of a large spectrum of both general and specialized signaling pathway. SFN binds to a large number of partners, usually by recognition of a phosphoserine or phosphothreonine motif. Binding generally results in the modulation of the activity of the binding partner. When bound to KRT17, SFN regulates protein synthesis and epithelial cell growth by stimulating Akt/mTOR pathway.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 11.9pg/mL |
SFN ELISA Kit (Human) (OKEH02507) |
OKEH02507 |
Aviva Systems Biology |
96 Wells |
EUR 779 |
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 18 pg/mL |
Monoclonal SFN / Stratifin / 14-3-3 Sigma Antibody (clone 3C3), Clone: 3C3 |
APR13297G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A Monoclonal antibody against Human SFN / Stratifin / 14-3-3 Sigma (clone 3C3). The antibodies are raised in Mouse and are from clone 3C3. This antibody is applicable in WB and IHC-P |
SFN ELISA Kit (Bovine) (OKEH08146) |
OKEH08146 |
Aviva Systems Biology |
96 Wells |
EUR 1092 |
Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
Stratifin Antibody (Biotin) |
abx430936-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
SFN antibody |
70R-5570 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal SFN antibody raised against the middle region of SFN |
SFN antibody |
70R-9288 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal SFN antibody |
SFN Antibody |
43001-100ul |
SAB |
100ul |
EUR 252 |
SFN Antibody |
32126-100ul |
SAB |
100ul |
EUR 252 |
SFN antibody |
70R-20201 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal SFN antibody |
SFN antibody |
70R-14334 |
Fitzgerald |
100 ug |
EUR 322 |
Description: Affinity purified Rabbit polyclonal SFN antibody |
SFN Antibody |
DF6189 |
Affbiotech |
200ul |
EUR 304 |
Description: SFN Antibody detects endogenous levels of total SFN. |
SFN siRNA |
20-abx933104 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SFN siRNA |
20-abx933105 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SFN Antibody |
1-CSB-PA008892 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against SFN. Recognizes SFN from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000 |
SFN Antibody |
1-CSB-PA021135GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20oC, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against SFN. Recognizes SFN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA |
SFN Antibody |
1-CSB-PA021135LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against SFN. Recognizes SFN from Human, Rat, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:500-1:1000, IF:1:200-1:500 |
Human SFN shRNA Plasmid |
20-abx951877 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
SFN Recombinant Protein (Human) |
RP028300 |
ABM |
100 ug |
Ask for price |
SFN Recombinant Protein (Human) |
RP028303 |
ABM |
100 ug |
Ask for price |
Human 14-3-3 protein sigma(SFN) ELISA kit |
E01P0214-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human 14-3-3 protein sigma(SFN) ELISA kit |
E01P0214-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human 14-3-3 protein sigma(SFN) ELISA kit |
E01P0214-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human SFN/ 14-3-3 protein sigma ELISA Kit |
E2271Hu |
Sunlong |
1 Kit |
EUR 605 |
Human SFN(14-3-3 protein sigma) ELISA Kit |
EH1771 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 78-5000 pg/ml
- Uniprot ID: P31947
- Alias: SFN/14-3-3 protein sigma/Epithelial cell marker protein 1/Stratifin/HME1/YWHAS
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9pg/ml |
Human 14-3-3 protein sigma (SFN) ELISA Kit |
abx251077-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
Human 14-3-3 protein sigma(SFN) ELISA kit |
CSB-EL021135HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human 14-3-3 protein sigma (SFN) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human 14-3-3 protein sigma(SFN) ELISA kit |
1-CSB-EL021135HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human 14-3-3 protein sigma(SFN) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
SFN Conjugated Antibody |
C32126 |
SAB |
100ul |
EUR 397 |
SFN cloning plasmid |
CSB-CL021135HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 747
- Sequence: atggagagagccagtctgatccagaaggccaagctggcagagcaggccgaacgctatgaggacatggcagccttcatgaaaggcgccgtggagaagggcgaggagctctcctgcgaagagcgaaacctgctctcagtagcctataagaacgtggtgggcggccagagggctgcctg
- Show more
|
Description: A cloning plasmid for the SFN gene. |
SFN cloning plasmid |
CSB-CL021135HU2-10ug |
Cusabio |
10ug |
EUR 292 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 651
- Sequence: atggagagagccagtctgatccagaaggccaagctggcagagcaggccgaacgctatgaggacatggcagccttcatgaaaggcgccgtggagaagggcgaggagctctcctgcgaagagcgaaacctgctctcagtagcctataagaacgtggtgggcggccagagggctgcctg
- Show more
|
Description: A cloning plasmid for the SFN gene. |
anti- SFN antibody |
FNab09897 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500 - 1:2000
- IHC: 1:50 - 1:200
- IF: 1:50 - 1:100
- Immunogen: 14-3-3 protein sigma
- Uniprot ID: P31947
- Gene ID: 2810
- Research Area: Neuroscience, Signal Transduction
|
Description: Antibody raised against SFN |
SFN Polyclonal Antibody |
A-2745 |
EpiGentek |
100 µl |
EUR 483.55 |
Description: kits suitable for this type of research |
SFN Rabbit pAb |
A1026-100ul |
Abclonal |
100 ul |
EUR 308 |
SFN Rabbit pAb |
A1026-200ul |
Abclonal |
200 ul |
EUR 459 |
SFN Rabbit pAb |
A1026-20ul |
Abclonal |
20 ul |
EUR 183 |
SFN Rabbit pAb |
A1026-50ul |
Abclonal |
50 ul |
EUR 223 |
SFN Blocking Peptide |
33R-2923 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SFN antibody, catalog no. 70R-5570 |
SFN Blocking Peptide |
33R-9879 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SFN antibody, catalog no. 70R-9288 |
SFN Blocking Peptide |
DF6189-BP |
Affbiotech |
1mg |
EUR 195 |
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
SFN ORF Vector (Human) (pORF) |
ORF009434 |
ABM |
1.0 ug DNA |
EUR 95 |
SFN ORF Vector (Human) (pORF) |
ORF009435 |
ABM |
1.0 ug DNA |
EUR 95 |
Column Packing Kit |
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
PCR Mycoplasma Detection Kit |
M034-Kit |
TOKU-E |
Kit |
EUR 266 |
ELISA kit for Human 14-3-3 protein sigma (SFN) |
KTE60683-48T |
Abbkine |
48T |
EUR 332 |
- Stratifin, was shown to be diffusely distributed in the cytoplasm and was present in cultured epithelial cells. It was most abundant in tissues enriched in stratified keratinizing epithelium.The induction of 14-3-3-sigma is mediated by a p53 -respons
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human 14-3-3 protein sigma (SFN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human 14-3-3 protein sigma (SFN) |
KTE60683-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Stratifin, was shown to be diffusely distributed in the cytoplasm and was present in cultured epithelial cells. It was most abundant in tissues enriched in stratified keratinizing epithelium.The induction of 14-3-3-sigma is mediated by a p53 -respons
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human 14-3-3 protein sigma (SFN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human 14-3-3 protein sigma (SFN) |
KTE60683-96T |
Abbkine |
96T |
EUR 539 |
- Stratifin, was shown to be diffusely distributed in the cytoplasm and was present in cultured epithelial cells. It was most abundant in tissues enriched in stratified keratinizing epithelium.The induction of 14-3-3-sigma is mediated by a p53 -respons
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human 14-3-3 protein sigma (SFN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Polyclonal SFN Antibody (Center) |
APR17857G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SFN (Center). This antibody is tested and proven to work in the following applications: |
Polyclonal SFN Antibody (Center) |
APR13281G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SFN (Center). This antibody is tested and proven to work in the following applications: |
Mouse SFN shRNA Plasmid |
20-abx974565 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
SFN Antibody, HRP conjugated |
1-CSB-PA021135LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against SFN. Recognizes SFN from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
SFN Antibody, FITC conjugated |
1-CSB-PA021135LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against SFN. Recognizes SFN from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
SFN Antibody, Biotin conjugated |
1-CSB-PA021135LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against SFN. Recognizes SFN from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
SFN Recombinant Protein (Mouse) |
RP171359 |
ABM |
100 ug |
Ask for price |
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit |
CAS400A-KIT |
SBI |
1 kit (10 rxn) |
EUR 1110 |
|
SFN sgRNA CRISPR Lentivector set (Human) |
K2131401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Mouse 14-3-3 protein sigma (SFN) ELISA Kit |
abx556082-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Rat 14-3-3 protein sigma(SFN) ELISA kit |
E02P0214-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat 14-3-3 protein sigma(SFN) ELISA kit |
E02P0214-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat 14-3-3 protein sigma(SFN) ELISA kit |
E02P0214-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat 14-3-3 protein sigma(SFN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human SFN(Stratifin) ELISA Kit