Human TNMD(Tenomodulin) ELISA Kit
Human Tenomodulin (TNMD) ELISA Kit |
RD-TNMD-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Tenomodulin (TNMD) ELISA Kit |
abx572549-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human TNMD/ Tenomodulin ELISA Kit |
E2556Hu |
Sunlong |
1 Kit |
EUR 571 |
Human TNMD(Tenomodulin) ELISA Kit |
EH1104 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.312-20 ng/ml
- Uniprot ID: Q9H2S6
- Alias: TNMD(Tenomodulin)/UNQ771/CHM1L/TeM/hTeM/Tendin/Myodulin/Chondromodulin-1-like protein/Chondromodulin-I-like protein
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml |
Human Tenomodulin (TNMD) ELISA Kit |
20-abx153249 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Tenomodulin (TNMD) ELISA Kit |
abx250350-96tests |
Abbexa |
96 tests |
EUR 746 |
- Shipped within 5-12 working days.
|
Human Tenomodulin(TNMD) ELISA kit |
CSB-EL024007HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Tenomodulin (TNMD) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Tenomodulin(TNMD) ELISA kit |
1-CSB-EL024007HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Tenomodulin(TNMD) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human Tenomodulin (TNMD) ELISA Kit |
SEC798Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tenomodulin (TNMD) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tenomodulin (TNMD) in Tissue homogenates, cell lysates and other biological fluids. |
Human Tenomodulin (TNMD) ELISA Kit |
SEC798Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tenomodulin (TNMD) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tenomodulin (TNMD) in Tissue homogenates, cell lysates and other biological fluids. |
Human Tenomodulin (TNMD) ELISA Kit |
SEC798Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tenomodulin (TNMD) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tenomodulin (TNMD) in Tissue homogenates, cell lysates and other biological fluids. |
Human Tenomodulin (TNMD) ELISA Kit |
SEC798Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tenomodulin (TNMD) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tenomodulin (TNMD) in Tissue homogenates, cell lysates and other biological fluids. |
Human Tenomodulin (TNMD) ELISA Kit |
4-SEC798Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Tenomodulin elisa. Alternative names of the recognized antigen: TEM
- BRICD4
- CHM1-LIKE
- CHM1L
- Myodulin
- Tendin
- Chondromodulin-1-like protein
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Tenomodulin (TNMD) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Mouse Tenomodulin (TNMD) ELISA Kit |
abx514514-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Rat Tnmd/ Tenomodulin ELISA Kit |
E0991Ra |
Sunlong |
1 Kit |
EUR 571 |
Rat Tnmd(Tenomodulin) ELISA Kit |
ER0403 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: Q9ESC2
- Alias: TNMD(Tenomodulin)/UNQ771/CHM1L/TeM/hTeM/Tendin/Myodulin/Chondromodulin-1-like protein/Chondromodulin-I-like protein
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.094 ng/ml |
Rat Tenomodulin (TNMD) ELISA Kit |
abx256381-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Mouse Tenomodulin(TNMD) ELISA kit |
CSB-EL024007MO-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse Tenomodulin (TNMD) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Mouse Tenomodulin(TNMD) ELISA kit |
1-CSB-EL024007MO |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse Tenomodulin(TNMD) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Tenomodulin (TNMD) Antibody |
abx026953-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Tenomodulin (TNMD) Antibody |
abx026953-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Tenomodulin (TNMD) Antibody |
20-abx174740 |
Abbexa |
|
|
|
Tenomodulin (TNMD) Antibody |
20-abx338730 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Tenomodulin (TNMD) Antibody |
20-abx178548 |
Abbexa |
|
|
|
Mouse Tenomodulin (Tnmd) |
1-CSB-YP324007MO |
Cusabio |
-
EUR 679.00
-
EUR 335.00
-
EUR 2172.00
-
EUR 1051.00
-
EUR 1442.00
-
EUR 435.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 34.1 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Mouse Tenomodulin(Tnmd),partial expressed in Yeast |
Mouse Tenomodulin (Tnmd) |
1-CSB-EP024007MO |
Cusabio |
-
EUR 611.00
-
EUR 309.00
-
EUR 1827.00
-
EUR 939.00
-
EUR 1218.00
-
EUR 397.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 35.6 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Mouse Tenomodulin(Tnmd),partial expressed in E.coli |
ELISA kit for Human TNMD (Tenomodulin) |
ELK3581 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Tenomodulin (TNMD). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Tenomodulin (TN
- Show more
|
Description: A sandwich ELISA kit for detection of Tenomodulin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Human Tenomodulin (TNMD) |
KTE60192-48T |
Abbkine |
48T |
EUR 332 |
- By searching an EST database for sequences similar to mouse Tem, followed by RACE of a human fetus cDNA library, Shukunami et al. (2001) cloned TEM. The deduced 317-amino acid protein contains an N-terminal transmembrane domain and a putative antiang
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Tenomodulin (TNMD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Tenomodulin (TNMD) |
KTE60192-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- By searching an EST database for sequences similar to mouse Tem, followed by RACE of a human fetus cDNA library, Shukunami et al. (2001) cloned TEM. The deduced 317-amino acid protein contains an N-terminal transmembrane domain and a putative antiang
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Tenomodulin (TNMD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Tenomodulin (TNMD) |
KTE60192-96T |
Abbkine |
96T |
EUR 539 |
- By searching an EST database for sequences similar to mouse Tem, followed by RACE of a human fetus cDNA library, Shukunami et al. (2001) cloned TEM. The deduced 317-amino acid protein contains an N-terminal transmembrane domain and a putative antiang
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Tenomodulin (TNMD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Human Tenomodulin (TNMD) CLIA Kit |
20-abx493907 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Human Tenomodulin (TNMD) Protein |
20-abx655206 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
ELISA kit for Rat Tenomodulin (TNMD) |
KTE100063-48T |
Abbkine |
48T |
EUR 332 |
- By searching an EST database for sequences similar to mouse Tem, followed by RACE of a human fetus cDNA library, Shukunami et al. (2001) cloned TEM. The deduced 317-amino acid protein contains an N-terminal transmembrane domain and a putative antiang
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Tenomodulin (TNMD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Tenomodulin (TNMD) |
KTE100063-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- By searching an EST database for sequences similar to mouse Tem, followed by RACE of a human fetus cDNA library, Shukunami et al. (2001) cloned TEM. The deduced 317-amino acid protein contains an N-terminal transmembrane domain and a putative antiang
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Tenomodulin (TNMD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Tenomodulin (TNMD) |
KTE100063-96T |
Abbkine |
96T |
EUR 539 |
- By searching an EST database for sequences similar to mouse Tem, followed by RACE of a human fetus cDNA library, Shukunami et al. (2001) cloned TEM. The deduced 317-amino acid protein contains an N-terminal transmembrane domain and a putative antiang
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Tenomodulin (TNMD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Tenomodulin (TNMD) |
KTE70104-48T |
Abbkine |
48T |
EUR 332 |
- By searching an EST database for sequences similar to mouse Tem, followed by RACE of a human fetus cDNA library, Shukunami et al. (2001) cloned TEM. The deduced 317-amino acid protein contains an N-terminal transmembrane domain and a putative antiang
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Tenomodulin (TNMD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Tenomodulin (TNMD) |
KTE70104-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- By searching an EST database for sequences similar to mouse Tem, followed by RACE of a human fetus cDNA library, Shukunami et al. (2001) cloned TEM. The deduced 317-amino acid protein contains an N-terminal transmembrane domain and a putative antiang
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Tenomodulin (TNMD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Tenomodulin (TNMD) |
KTE70104-96T |
Abbkine |
96T |
EUR 539 |
- By searching an EST database for sequences similar to mouse Tem, followed by RACE of a human fetus cDNA library, Shukunami et al. (2001) cloned TEM. The deduced 317-amino acid protein contains an N-terminal transmembrane domain and a putative antiang
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Tenomodulin (TNMD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Tenomodulin (TNMD) Antibody (HRP) |
20-abx337925 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Tenomodulin (TNMD) Antibody (FITC) |
20-abx337926 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Tenomodulin (TNMD) Antibody (Biotin) |
20-abx337927 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
ELISA kit for Human Tenomodulin |
EK2501 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Tenomodulin in samples from serum, plasma, tissue homogenates and other biological fluids. |
TNMD ELISA Kit (Human) (OKCD08258) |
OKCD08258 |
Aviva Systems Biology |
96 Wells |
EUR 975 |
Description: Description of target: TNMD is a single-pass type II membrane proteinPotential. It belongs to the chondromodulin-1 family and contains 1 BRICHOS domain. TNMD may be an angiogenesis inhibitor.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.114ng/mL |
Tenomodulin antibody |
70R-6905 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal Tenomodulin antibody raised against the N terminal of TNMD |
Tenomodulin antibody |
70R-6317 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal Tenomodulin antibody raised against the middle region of TNMD |
TNMD ELISA Kit (Rat) (OKEH04398) |
OKEH04398 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: transmembrane protein; may be an angiogenesis inhibitor; may play a regulatory role in eye and skeletal muscle development [RGD, Feb 2006];Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Competitive ELISA;Sensitivity: 0.089 ng/mL |
TNMD ELISA Kit (Mouse) (OKCA02464) |
OKCA02464 |
Aviva Systems Biology |
96 Wells |
EUR 846 |
Description: Description of target: May be an angiogenesis inhibitor. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: 2.34 pg/mL |
TNMD ELISA Kit (Mouse) (OKEH05757) |
OKEH05757 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: May be an angiogenesis inhibitor. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.088 ng/mL |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
TNMD siRNA |
20-abx905713 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TNMD siRNA |
20-abx937662 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TNMD siRNA |
20-abx937663 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TNMD Antibody |
43641-100ul |
SAB |
100ul |
EUR 252 |
TNMD Antibody |
1-CSB-PA024007LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against TNMD. Recognizes TNMD from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:50-1:200 |
Tenomodulin Blocking Peptide |
33R-4477 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TNMD antibody, catalog no. 70R-6905 |
Tenomodulin Blocking Peptide |
33R-7661 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TNMD antibody, catalog no. 70R-6317 |
Human TNMD shRNA Plasmid |
20-abx961920 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
TNMD Recombinant Protein (Human) |
RP032482 |
ABM |
100 ug |
Ask for price |
TNMD Conjugated Antibody |
C43641 |
SAB |
100ul |
EUR 397 |
TNMD cloning plasmid |
CSB-CL024007HU-10ug |
Cusabio |
10ug |
EUR 285 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 624
- Sequence: atggcaaagaatcctccagagaattgtgaagactgtcacattctaaatgcagaagcttttaaatccaagaaaatatgtaaatcacttaagatttgtggactggtgtttggtatcctggccctaactctaattgtcctgttttgggggagcaagcacttctggccggaggtacccaa
- Show more
|
Description: A cloning plasmid for the TNMD gene. |
TNMD Rabbit pAb |
A17753-100ul |
Abclonal |
100 ul |
EUR 308 |
TNMD Rabbit pAb |
A17753-200ul |
Abclonal |
200 ul |
EUR 459 |
TNMD Rabbit pAb |
A17753-20ul |
Abclonal |
20 ul |
EUR 183 |
TNMD Rabbit pAb |
A17753-50ul |
Abclonal |
50 ul |
EUR 223 |
Recombinant mouse Tnmd |
P1421 |
FN Test |
100ug |
Ask for price |
- Uniprot ID: Q9EP64
- Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
|
Description: Recombinant protein for mouse Tnmd |
Anti-TNMD antibody |
STJ119792 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a protein that is related to chondromodulin-I, which is a cartilage-specific glycoprotein that functions to stimulate chondrocyte growth and to inhibit tube formation of endothelial cells. This protein is also an angiogenesis inhibitor. Genetic variation in this gene is associated with a risk for type 2 diabetes, central obesity and serum levels of systemic immune mediators in a body size-dependent manner. This gene is also a candidate gene for age-related macular degeneration, though a direct link has yet to be demonstrated. [provided by RefSeq, Sep 2009] |
TNMD ORF Vector (Human) (pORF) |
ORF010828 |
ABM |
1.0 ug DNA |
EUR 95 |
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
Column Packing Kit |
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
Polyclonal TNMD Antibody (Center) |
APR03728G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TNMD (Center). This antibody is tested and proven to work in the following applications: |
Mouse TNMD shRNA Plasmid |
20-abx975257 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Rat TNMD shRNA Plasmid |
20-abx986157 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
TNMD Antibody, HRP conjugated |
1-CSB-PA024007LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against TNMD. Recognizes TNMD from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
TNMD Antibody, FITC conjugated |
1-CSB-PA024007LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against TNMD. Recognizes TNMD from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
TNMD Antibody, Biotin conjugated |
1-CSB-PA024007LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against TNMD. Recognizes TNMD from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
TNMD Recombinant Protein (Rat) |
RP234134 |
ABM |
100 ug |
Ask for price |
TNMD Recombinant Protein (Mouse) |
RP180350 |
ABM |
100 ug |
Ask for price |
PCR Mycoplasma Detection Kit |
M034-Kit |
TOKU-E |
Kit |
EUR 266 |
TNMD sgRNA CRISPR Lentivector set (Human) |
K2419001 |
ABM |
3 x 1.0 ug |
EUR 339 |
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit |
CAS400A-KIT |
SBI |
1 kit (10 rxn) |
EUR 1110 |
|
CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV100PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV105PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV120PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV125PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS700A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS720A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS740A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Tnmd ORF Vector (Mouse) (pORF) |
ORF060118 |
ABM |
1.0 ug DNA |
EUR 506 |
Tnmd ORF Vector (Rat) (pORF) |
ORF078046 |
ABM |
1.0 ug DNA |
EUR 506 |
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents) |
CAS510A-KIT |
SBI |
1 Kit |
EUR 805 |
|
TNMD sgRNA CRISPR Lentivector (Human) (Target 1) |
K2419002 |
ABM |
1.0 ug DNA |
EUR 154 |
TNMD sgRNA CRISPR Lentivector (Human) (Target 2) |
K2419003 |
ABM |
1.0 ug DNA |
EUR 154 |
TNMD sgRNA CRISPR Lentivector (Human) (Target 3) |
K2419004 |
ABM |
1.0 ug DNA |
EUR 154 |
TNMD Protein Vector (Human) (pPB-C-His) |
PV043309 |
ABM |
500 ng |
EUR 329 |
TNMD Protein Vector (Human) (pPB-N-His) |
PV043310 |
ABM |
500 ng |
EUR 329 |
TNMD Protein Vector (Human) (pPM-C-HA) |
PV043311 |
ABM |
500 ng |
EUR 329 |
TNMD Protein Vector (Human) (pPM-C-His) |
PV043312 |
ABM |
500 ng |
EUR 329 |
Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV200PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV205PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV220PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV225PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
CAS750A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
CAS770A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
CAS790A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)] |
CAS9LIG-KIT |
SBI |
1 Kit |
EUR 153 |
|
PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN320A-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN340iPS-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
GE620A-KIT |
SBI |
1 kit |
EUR 2132 |
|
AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
GE622A-KIT |
SBI |
1 kit |
EUR 2132 |
|
AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
GE624A-KIT |
SBI |
1 kit |
EUR 2132 |
|
Tnmd sgRNA CRISPR Lentivector set (Mouse) |
K3684001 |
ABM |
3 x 1.0 ug |
EUR 339 |
Tnmd sgRNA CRISPR Lentivector set (Rat) |
K6960501 |
ABM |
3 x 1.0 ug |
EUR 339 |
vWF Acty. Kit |
ABP-ACT-KIT |
Abpcorp |
12 x 8 microwells |
EUR 428 |
vWF Ant. Kit |
ABP-TOT-KIT |
Abpcorp |
12 x 8 microwells |
EUR 394 |
hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9) |
CAS620A-KIT |
SBI |
1 kit |
EUR 2152 |
|
Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression) |
PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN300A-KIT |
SBI |
1 Kit |
EUR 2798 |
- Category: PinPoint Integrase Tools
|
PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN400A-KIT |
SBI |
1 Kit |
EUR 2798 |
- Category: PinPoint Integrase Tools
|
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN410A-KIT |
SBI |
1 Kit |
EUR 4335 |
- Category: PinPoint Integrase Tools
|
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN412A-KIT |
SBI |
1 Kit |
EUR 4335 |
- Category: PinPoint Integrase Tools
|
PrecisionX Multiplex gRNA Cloning Kit |
CAS9-GRNA-KIT |
SBI |
10 rxn |
EUR 445 |
|
Tnmd sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3684002 |
ABM |
1.0 ug DNA |
EUR 154 |
Tnmd sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3684003 |
ABM |
1.0 ug DNA |
EUR 154 |
Human TNMD(Tenomodulin) ELISA Kit