Biochar-based fertilizer amendments improve the soil microbial community structure in a karst mountainous area

August 20, 2021 0 Comments


Notice: Trying to access array offset on value of type bool in /home/fwsoeulh/domains/micca.org/public_html/wp-content/plugins/gentaur-linking/app/Libs/LSPDRequest.php on line 194

Notice: Trying to access array offset on value of type bool in /home/fwsoeulh/domains/micca.org/public_html/wp-content/plugins/gentaur-linking/app/Libs/LSPDRequest.php on line 208

Notice: Trying to access array offset on value of type bool in /home/fwsoeulh/domains/micca.org/public_html/wp-content/plugins/gentaur-linking/app/Libs/LSPDRequest.php on line 229

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/micca.org/public_html/wp-content/plugins/gentaur-linking/vendor_prefixed/pwpf/src/View/View.php on line 103

Biochar-based fertilizer modification can improve soil properties partly as a result of stimulated microbial actions and growths. The karst ecosystem is vulnerable to degradation and accounts for a giant proportion of southwest China. Understanding of the response of the microbial community structure to biochar-based fertilizer software is of nice significance in karst soil restoration.
A subject experiment positioned in southwest China was performed in typical karst soil, and a high-throughput sequencing method was used to analyze the impact of biochar-based fertilizer software on microbial community structure in karst soil. Field trials had been arrange for 24 months utilizing the following remedies: management (CK), compost plus NPK fertilizer (MF), biochar (B), much less biochar (half the amount of biochar in B) plus compost and NPK fertilizer (B1MF), biochar plus compost and NPK fertilizer (BMF), and extra biochar (double the amount of biochar in B) plus compost and NPK fertilizer (B4MF).
The outcomes elucidated that BMF and B4MF remedies had larger contents of soil carbon and soil vitamins N, P, and Ok than the different remedies. Soil microbial abundance and variety had been considerably elevated by biochar-based fertilizer amendments (BMF and B4MF), in comparison with CK (P < 0.05). BMF and B4MF remedies considerably elevated the relative abundance of dominant microorganisms, in comparison with CK (P < 0.05). The distinction in the composition of indicator microbes between every handled group indicated that soil amendments altered the microbial community structure.
There was a sturdy correlation between soil properties (soil C-, N-, and P-fractions) and microbial community structure. Furthermore, community evaluation revealed that the addition of biochar-based fertilizer elevated the scale and complexity of the microbial co-occurrence community. To summarize, the software of biochar-based fertilizer enabled extra keystone species in the soil microbial community to take part in soil carbon useful resource administration and soil nutrient biking, indicating that biochar-based fertilizer is useful for the restoration of karst-degraded soils.

Microbial Communities on Plastic Polymers in the Mediterranean Sea

Plastic particles in the ocean are usually coated with microbial biofilms, but it surely stays unclear whether or not distinct microbial communities colonize completely different polymer varieties. In this research, we analyzed microbial communities forming biofilms on floating microplastics in a bay of the island of Elba in the Mediterranean Sea. Raman spectroscopy revealed that the plastic particles primarily comprised polyethylene (PE), polypropylene (PP), and polystyrene (PS) of which polyethylene and polypropylene particles had been usually brittle and featured cracks.
Fluorescence in situ hybridization and imaging by high-resolution microscopy revealed dense microbial biofilms on the polymer surfaces. Amplicon sequencing of the 16S rRNA gene confirmed that the bacterial communities on all plastic varieties consisted primarily of the orders Flavobacteriales, Rhodobacterales, Cytophagales, Rickettsiales, Alteromonadales, Chitinophagales, and Oceanospirillales.
We discovered important variations in the biofilm community composition on PE in contrast with PP and PS (on OTU and order degree), which exhibits that completely different microbial communities colonize particular polymer varieties. Furthermore, the sequencing knowledge additionally revealed a larger relative abundance of archaeal sequences on PS in comparability with PE or PP. We moreover discovered a excessive prevalence, as much as 17% of all sequences, of various hydrocarbon-degrading micro organism on all investigated plastic varieties. However, their functioning in the plastic-associated biofilm and potential position in plastic degradation wants additional evaluation.
Biochar-based fertilizer amendments improve the soil microbial community structure in a karst mountainous area

Effects and Mechanisms of Symbiotic Microbial Combination Agents to Control Tomato Fusarium Crown and Root Rot Disease

This research evaluated the results and underlying mechanisms of various mixtures of plant symbiotic microbes, comprising arbuscular mycorrhizal fungi (AMF), plant growth-promoting rhizobacteria (PGPR), and Trichoderma spp., on tomato Fusarium crown and root rot (TFCRR) resistance. A complete of 54 remedies had been utilized in a greenhouse pot experiment to tomato (Solanum lycopersicum) seedlings inoculated with or with out Funneliformis mosseae (Fm), Rhizophagus intraradices (Ri), Trichoderma virens l40012 (Tv), Trichoderma harzianum l40015 (Th), Bacillus subtilis PS1-3 (Bs), Pseudomonas fluorescens PS2-6 (Pf), and Fusarium oxysporum f. sp. radicis-lycopersici (Fo).
The symbioses on the tomato root system had been properly developed, and the composite symbiont generated by AMF + Trichoderma spp. was noticed for the first time. Compared with different remedies, Ri + Bs + Tv and Fm + Pf + Tv stimulated the best enhancements in tomato progress and yield. The mixture Ri + Pf + Th + Fo resulted in the strongest biocontrol results on TFCRR, adopted by the remedies Th + Pf + Fo and Ri + Th + Fo.
Compared with the Fo remedy, most inoculation remedies improved photosynthetic efficiency and considerably elevated protection enzyme exercise in tomato crops, of which the remedy Ri + Pf + Th + Fo confirmed the highest enzyme exercise. Metabolome evaluation detected adjustments in a whole of 1,266 metabolites. The variety of up-regulated metabolites in tomato crops inoculated with Ri + Pf + Th and Ri + Pf + Th + Fo exceeded that of the Fo remedy, whereas the variety of down-regulated metabolites confirmed the reverse development.

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/micca.org/public_html/wp-content/plugins/gentaur-linking/vendor_prefixed/pwpf/src/View/View.php on line 64

PRKAR1A (PRKAR1A) Antibody

abx332777-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

PRKAR1A (PRKAR1A) Antibody

20-abx000892
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Prkar1a/ Rat Prkar1a ELISA Kit

ELI-21280r 96 Tests
EUR 886

PRKAR1A antibody

70R-19518 50 ul
EUR 435
Description: Rabbit polyclonal PRKAR1A antibody

PRKAR1A Antibody

32091-100ul 100ul
EUR 252

PRKAR1A antibody

10R-1477 100 ug
EUR 512
Description: Mouse monoclonal PRKAR1A antibody

PRKAR1A Antibody

1-CSB-PA003796
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against PRKAR1A. Recognizes PRKAR1A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000

PRKAR1A Antibody

CSB-PA913762-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against PRKAR1A. Recognizes PRKAR1A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

PRKAR1A Antibody

CSB-PA913762-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against PRKAR1A. Recognizes PRKAR1A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

PRKAR1A Antibody

DF6142 200ul
EUR 304
Description: PRKAR1A Antibody detects endogenous levels of total PRKAR1A.

PRKAR1A antibody

70R-50250 100 ul
EUR 244
Description: Purified Polyclonal PRKAR1A antibody

PRKAR1A antibody

70R-9554 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal PRKAR1A antibody

PRKAR1A Antibody

1-CSB-PA018694GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PRKAR1A. Recognizes PRKAR1A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

PRKAR1A siRNA

20-abx904235
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PRKAR1A siRNA

20-abx929751
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PRKAR1A siRNA

20-abx929752
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PRKAR1A Antibody

ABD6142 100 ug
EUR 438

anti-PRKAR1A

YF-PA13986 50 ug
EUR 363
Description: Mouse polyclonal to PRKAR1A

anti-PRKAR1A

YF-PA13987 100 ug
EUR 403
Description: Rabbit polyclonal to PRKAR1A

anti-PRKAR1A

YF-PA24453 50 ul
EUR 334
Description: Mouse polyclonal to PRKAR1A

PRKAR1A Rabbit pAb

A0906-100ul 100 ul
EUR 308

PRKAR1A Rabbit pAb

A0906-200ul 200 ul
EUR 459

PRKAR1A Rabbit pAb

A0906-20ul 20 ul
EUR 183

PRKAR1A Rabbit pAb

A0906-50ul 50 ul
EUR 223

PRKAR1A Blocking Peptide

33R-6264 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PRKAR1A antibody, catalog no. 70R-9554

PRKAR1A Blocking Peptide

DF6142-BP 1mg
EUR 195

PRKAR1A Blocking Peptide

20-abx063125
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

PRKAR1A Conjugated Antibody

C32091 100ul
EUR 397

PRKAR1A cloning plasmid

CSB-CL018694HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1146
  • Sequence: atggagtctggcagtaccgccgccagtgaggaggcacgcagccttcgagaatgtgagctctacgtccagaagcataacattcaagcgctgctcaaagattctattgtgcagttgtgcactgctcgacctgagagacccatggcattcctcagggaatactttgagaggttggaga
  • Show more
Description: A cloning plasmid for the PRKAR1A gene.

anti- PRKAR1A antibody

FNab06779 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: protein kinase, cAMP-dependent, regulatory, type I, alpha (tissue specific extinguisher 1)
  • Uniprot ID: P10644
  • Gene ID: 5573
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against PRKAR1A

Anti-PRKAR1A antibody

PAab06779 100 ug
EUR 386

pENTR223-PRKAR1A vector

PVT12021 2 ug
EUR 308

Anti-PRKAR1A antibody

STJ25122 100 µl
EUR 277
Description: cAMP is a signaling molecule important for a variety of cellular functions. cAMP exerts its effects by activating the cAMP-dependent protein kinase, which transduces the signal through phosphorylation of different target proteins. The inactive kinase holoenzyme is a tetramer composed of two regulatory and two catalytic subunits. cAMP causes the dissociation of the inactive holoenzyme into a dimer of regulatory subunits bound to four cAMP and two free monomeric catalytic subunits. Four different regulatory subunits and three catalytic subunits have been identified in humans. This gene encodes one of the regulatory subunits. This protein was found to be a tissue-specific extinguisher that down-regulates the expression of seven liver genes in hepatoma x fibroblast hybrids. Mutations in this gene cause Carney complex (CNC). This gene can fuse to the RET protooncogene by gene rearrangement and form the thyroid tumor-specific chimeric oncogene known as PTC2. A nonconventional nuclear localization sequence (NLS) has been found for this protein which suggests a role in DNA replication via the protein serving as a nuclear transport protein for the second subunit of the Replication Factor C (RFC40). Several alternatively spliced transcript variants encoding two different isoforms have been observed.

Anti-PRKAR1A antibody

STJ119978 100 µl
EUR 413
Description: cAMP is a signaling molecule important for a variety of cellular functions. cAMP exerts its effects by activating the cAMP-dependent protein kinase, which transduces the signal through phosphorylation of different target proteins. The inactive kinase holoenzyme is a tetramer composed of two regulatory and two catalytic subunits. cAMP causes the dissociation of the inactive holoenzyme into a dimer of regulatory subunits bound to four cAMP and two free monomeric catalytic subunits. Four different regulatory subunits and three catalytic subunits have been identified in humans. This gene encodes one of the regulatory subunits. This protein was found to be a tissue-specific extinguisher that down-regulates the expression of seven liver genes in hepatoma x fibroblast hybrids. Mutations in this gene cause Carney complex (CNC). This gene can fuse to the RET protooncogene by gene rearrangement and form the thyroid tumor-specific chimeric oncogene known as PTC2. A nonconventional nuclear localization sequence (NLS) has been found for this protein which suggests a role in DNA replication via the protein serving as a nuclear transport protein for the second subunit of the Replication Factor C (RFC40). Several alternatively spliced transcript variants encoding two different isoforms have been observed.

Bovine PRKAR1A ELISA KIT

ELI-19993b 96 Tests
EUR 928

Chicken PRKAR1A ELISA KIT

ELI-08146c 96 Tests
EUR 928

PRKAR1A ELISA KIT|Human

EF002052 96 Tests
EUR 689

Human PRKAR1A ELISA KIT

ELI-44145h 96 Tests
EUR 824

Mouse PRKAR1A shRNA Plasmid

20-abx972194
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat PRKAR1A shRNA Plasmid

20-abx985255
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PRKAR1A shRNA Plasmid

20-abx953744
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Prkar1a ELISA KIT

ELI-39208m 96 Tests
EUR 865

pCMV-SPORT6-Prkar1a-m

PVT18912 2 ug
EUR 231

PRKAR1A Recombinant Protein (Human)

RP024610 100 ug Ask for price

PRKAR1A Recombinant Protein (Mouse)

RP164423 100 ug Ask for price

PRKAR1A Recombinant Protein (Rat)

RP222047 100 ug Ask for price

[KO Validated] PRKAR1A Rabbit pAb

A18005-100ul 100 ul
EUR 410

[KO Validated] PRKAR1A Rabbit pAb

A18005-200ul 200 ul
EUR 571

[KO Validated] PRKAR1A Rabbit pAb

A18005-20ul 20 ul
EUR 221

[KO Validated] PRKAR1A Rabbit pAb

A18005-50ul 50 ul
EUR 287

Prkar1a ORF Vector (Rat) (pORF)

ORF074017 1.0 ug DNA
EUR 506

PRKAR1A ORF Vector (Human) (pORF)

ORF008204 1.0 ug DNA
EUR 95

Prkar1a ORF Vector (Mouse) (pORF)

ORF054809 1.0 ug DNA
EUR 506

Prkar1a sgRNA CRISPR Lentivector set (Mouse)

K4847701 3 x 1.0 ug
EUR 339

Prkar1a sgRNA CRISPR Lentivector set (Rat)

K6799101 3 x 1.0 ug
EUR 339

PRKAR1A sgRNA CRISPR Lentivector set (Human)

K1721001 3 x 1.0 ug
EUR 339

Prkar1a sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4847702 1.0 ug DNA
EUR 154

Prkar1a sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4847703 1.0 ug DNA
EUR 154

Prkar1a sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4847704 1.0 ug DNA
EUR 154

Prkar1a sgRNA CRISPR Lentivector (Rat) (Target 1)

K6799102 1.0 ug DNA
EUR 154

Prkar1a sgRNA CRISPR Lentivector (Rat) (Target 2)

K6799103 1.0 ug DNA
EUR 154

Prkar1a sgRNA CRISPR Lentivector (Rat) (Target 3)

K6799104 1.0 ug DNA
EUR 154

PRKAR1A sgRNA CRISPR Lentivector (Human) (Target 1)

K1721002 1.0 ug DNA
EUR 154

PRKAR1A sgRNA CRISPR Lentivector (Human) (Target 2)

K1721003 1.0 ug DNA
EUR 154

PRKAR1A sgRNA CRISPR Lentivector (Human) (Target 3)

K1721004 1.0 ug DNA
EUR 154

PRKAR1A Protein Vector (Rat) (pPB-C-His)

PV296066 500 ng
EUR 603

PRKAR1A Protein Vector (Rat) (pPB-N-His)

PV296067 500 ng
EUR 603

PRKAR1A Protein Vector (Rat) (pPM-C-HA)

PV296068 500 ng
EUR 603

PRKAR1A Protein Vector (Rat) (pPM-C-His)

PV296069 500 ng
EUR 603

PRKAR1A Protein Vector (Human) (pPB-C-His)

PV032813 500 ng
EUR 329

PRKAR1A Protein Vector (Human) (pPB-N-His)

PV032814 500 ng
EUR 329

PRKAR1A Protein Vector (Human) (pPM-C-HA)

PV032815 500 ng
EUR 329

PRKAR1A Protein Vector (Human) (pPM-C-His)

PV032816 500 ng
EUR 329

PRKAR1A Protein Vector (Mouse) (pPB-C-His)

PV219234 500 ng
EUR 603

PRKAR1A Protein Vector (Mouse) (pPB-N-His)

PV219235 500 ng
EUR 603

PRKAR1A Protein Vector (Mouse) (pPM-C-HA)

PV219236 500 ng
EUR 603

PRKAR1A Protein Vector (Mouse) (pPM-C-His)

PV219237 500 ng
EUR 603

Prkar1a 3'UTR Luciferase Stable Cell Line

TU116944 1.0 ml Ask for price

Prkar1a 3'UTR GFP Stable Cell Line

TU166944 1.0 ml Ask for price

Prkar1a 3'UTR Luciferase Stable Cell Line

TU216768 1.0 ml Ask for price

Prkar1a 3'UTR GFP Stable Cell Line

TU266768 1.0 ml Ask for price

PRKAR1A 3'UTR GFP Stable Cell Line

TU068820 1.0 ml
EUR 2333

PRKAR1A 3'UTR Luciferase Stable Cell Line

TU018820 1.0 ml
EUR 2333

PRKAR1A Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV672373 1.0 ug DNA
EUR 682

PRKAR1A Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV672377 1.0 ug DNA
EUR 682

PRKAR1A Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV672378 1.0 ug DNA
EUR 682

Recombinant Multi Species PRKAR1A Protein, Untagged, E.coli-100ug

QP13143-100ug 100ug
EUR 3754

Recombinant Multi Species PRKAR1A Protein, Untagged, E.coli-1ug

QP13143-1ug 1ug
EUR 155

Recombinant Multi Species PRKAR1A Protein, Untagged, E.coli-3ug

QP13143-3ug 3ug
EUR 201

Anti-Protein Kinase A regulatory subunit I alpha/PRKAR1A Antibody

A00699-1 100ug/vial
EUR 334

Recombinant Human cAMP-Dependent Protein Kinase 1α/PRKAR1A (C-6His)

CJ31-10ug 10ug
EUR 100
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

Recombinant Human cAMP-Dependent Protein Kinase 1α/PRKAR1A (C-6His)

CJ31-1mg 1mg
EUR 1115
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

Recombinant Human cAMP-Dependent Protein Kinase 1α/PRKAR1A (C-6His)

CJ31-500ug 500ug
EUR 709
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

Recombinant Human cAMP-Dependent Protein Kinase 1α/PRKAR1A (C-6His)

CJ31-50ug 50ug
EUR 156
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

Prkar1a sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4847705 3 x 1.0 ug
EUR 376

Prkar1a sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6799105 3 x 1.0 ug
EUR 376

PRKAR1A sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1721005 3 x 1.0 ug
EUR 376

Human CAMP-Dependent Protein Kinase Regulatory Subunit RIalpha (PRKAR1A) ELISA Kit

abx259799-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

PRKAR1A Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV672374 1.0 ug DNA
EUR 682

PRKAR1A Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV672375 1.0 ug DNA
EUR 740

PRKAR1A Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV672376 1.0 ug DNA
EUR 740

Prkar1a sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K4847706 1.0 ug DNA
EUR 167

Prkar1a sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K4847707 1.0 ug DNA
EUR 167

Prkar1a sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K4847708 1.0 ug DNA
EUR 167

Prkar1a sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K6799106 1.0 ug DNA
EUR 167

Prkar1a sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K6799107 1.0 ug DNA
EUR 167

Prkar1a sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K6799108 1.0 ug DNA
EUR 167

PRKAR1A sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K1721006 1.0 ug DNA
EUR 167

PRKAR1A sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K1721007 1.0 ug DNA
EUR 167

PRKAR1A sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K1721008 1.0 ug DNA
EUR 167

PRKAR1A cAMP-Dependent Protein Kinase A regulatory subunit I a Recombinant Protein

PROTP10644 Regular: 3ug
EUR 317
Description: cAMP-dependent PKA is an ubiquitous serine/theonine protein kinase present in a variety of tissues (e.g. brain, skeletal muscle, heart). The intracellular cAMP level regulates cellular responses by altering the interaction between the catatytic C and regulatory R subunits of PKA. The inactive tetrameric PKA holoenzyme R2C2 is activated when cAMP binds to R2, which dissociates the tetramer to R2 cAMP 4 and two active catalytic subunits. Free Catalytic subunits of PKA can phosphorylate a wide variety of intracellular target proteins. In response to hormone- induced high cAMP levels, PKA phosphorylates glycogen synthetase (inhibition of the enzyme activity) and phosphorylase kinase to block glycogen synthesis. Different isoforms of catalytic and regulatory subunits suggest specific functions. The recombinant PKA regulatory subunit I a is a dimeric 90kDa protein.

Rat cAMP dependent protein kinase type I Alpha regulatory subunit(PRKAR1A) ELISA kit

E02C2404-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat cAMP dependent protein kinase type I Alpha regulatory subunit(PRKAR1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat cAMP dependent protein kinase type I Alpha regulatory subunit(PRKAR1A) ELISA kit

E02C2404-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat cAMP dependent protein kinase type I Alpha regulatory subunit(PRKAR1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat cAMP dependent protein kinase type I Alpha regulatory subunit(PRKAR1A) ELISA kit

E02C2404-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat cAMP dependent protein kinase type I Alpha regulatory subunit(PRKAR1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human cAMP dependent protein kinase type I Alpha regulatory subunit(PRKAR1A) ELISA kit

E01C2404-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human cAMP dependent protein kinase type I Alpha regulatory subunit(PRKAR1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human cAMP dependent protein kinase type I Alpha regulatory subunit(PRKAR1A) ELISA kit

E01C2404-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human cAMP dependent protein kinase type I Alpha regulatory subunit(PRKAR1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human cAMP dependent protein kinase type I Alpha regulatory subunit(PRKAR1A) ELISA kit

E01C2404-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human cAMP dependent protein kinase type I Alpha regulatory subunit(PRKAR1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse cAMP dependent protein kinase type I Alpha regulatory subunit(PRKAR1A) ELISA kit

E03C2404-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse cAMP dependent protein kinase type I Alpha regulatory subunit(PRKAR1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse cAMP dependent protein kinase type I Alpha regulatory subunit(PRKAR1A) ELISA kit

E03C2404-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse cAMP dependent protein kinase type I Alpha regulatory subunit(PRKAR1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse cAMP dependent protein kinase type I Alpha regulatory subunit(PRKAR1A) ELISA kit

E03C2404-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse cAMP dependent protein kinase type I Alpha regulatory subunit(PRKAR1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat cAMP dependent protein kinase type I Alpha regulatory subunit(PRKAR1A) ELISA kit

E06C2404-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat cAMP dependent protein kinase type I Alpha regulatory subunit(PRKAR1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat cAMP dependent protein kinase type I Alpha regulatory subunit(PRKAR1A) ELISA kit

E06C2404-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat cAMP dependent protein kinase type I Alpha regulatory subunit(PRKAR1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat cAMP dependent protein kinase type I Alpha regulatory subunit(PRKAR1A) ELISA kit

E06C2404-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat cAMP dependent protein kinase type I Alpha regulatory subunit(PRKAR1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit cAMP dependent protein kinase type I Alpha regulatory subunit(PRKAR1A) ELISA kit

E04C2404-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit cAMP dependent protein kinase type I Alpha regulatory subunit(PRKAR1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit cAMP dependent protein kinase type I Alpha regulatory subunit(PRKAR1A) ELISA kit

E04C2404-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit cAMP dependent protein kinase type I Alpha regulatory subunit(PRKAR1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit cAMP dependent protein kinase type I Alpha regulatory subunit(PRKAR1A) ELISA kit

E04C2404-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit cAMP dependent protein kinase type I Alpha regulatory subunit(PRKAR1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey cAMP dependent protein kinase type I Alpha regulatory subunit(PRKAR1A) ELISA kit

E09C2404-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey cAMP dependent protein kinase type I Alpha regulatory subunit(PRKAR1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey cAMP dependent protein kinase type I Alpha regulatory subunit(PRKAR1A) ELISA kit

E09C2404-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey cAMP dependent protein kinase type I Alpha regulatory subunit(PRKAR1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey cAMP dependent protein kinase type I Alpha regulatory subunit(PRKAR1A) ELISA kit

E09C2404-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey cAMP dependent protein kinase type I Alpha regulatory subunit(PRKAR1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog cAMP dependent protein kinase type I Alpha regulatory subunit(PRKAR1A) ELISA kit

E08C2404-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine cAMP dependent protein kinase type I Alpha regulatory subunit(PRKAR1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog cAMP dependent protein kinase type I Alpha regulatory subunit(PRKAR1A) ELISA kit

E08C2404-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine cAMP dependent protein kinase type I Alpha regulatory subunit(PRKAR1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog cAMP dependent protein kinase type I Alpha regulatory subunit(PRKAR1A) ELISA kit

E08C2404-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine cAMP dependent protein kinase type I Alpha regulatory subunit(PRKAR1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig cAMP dependent protein kinase type I Alpha regulatory subunit(PRKAR1A) ELISA kit

E07C2404-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine cAMP dependent protein kinase type I Alpha regulatory subunit(PRKAR1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig cAMP dependent protein kinase type I Alpha regulatory subunit(PRKAR1A) ELISA kit

E07C2404-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine cAMP dependent protein kinase type I Alpha regulatory subunit(PRKAR1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig cAMP dependent protein kinase type I Alpha regulatory subunit(PRKAR1A) ELISA kit

E07C2404-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine cAMP dependent protein kinase type I Alpha regulatory subunit(PRKAR1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig cAMP dependent protein kinase type I Alpha regulatory subunit(PRKAR1A) ELISA kit

E05C2404-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig cAMP dependent protein kinase type I Alpha regulatory subunit(PRKAR1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig cAMP dependent protein kinase type I Alpha regulatory subunit(PRKAR1A) ELISA kit

E05C2404-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig cAMP dependent protein kinase type I Alpha regulatory subunit(PRKAR1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig cAMP dependent protein kinase type I Alpha regulatory subunit(PRKAR1A) ELISA kit

E05C2404-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig cAMP dependent protein kinase type I Alpha regulatory subunit(PRKAR1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Rat CAMP-dependent protein kinase type I-alpha regulatory subunit (PRKAR1A)

KTE100435-48T 48T
EUR 332
  • cAMP is a signaling molecule important for a variety of cellular functions. cAMP exerts its effects by activating the cAMP-dependent protein kinase A (PKA), which transduces the signal through phosphorylation of different target proteins. Four differ
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat CAMP-dependent protein kinase type I-alpha regulatory subunit (PRKAR1A) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat CAMP-dependent protein kinase type I-alpha regulatory subunit (PRKAR1A)

KTE100435-5platesof96wells 5 plates of 96 wells
EUR 2115
  • cAMP is a signaling molecule important for a variety of cellular functions. cAMP exerts its effects by activating the cAMP-dependent protein kinase A (PKA), which transduces the signal through phosphorylation of different target proteins. Four differ
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat CAMP-dependent protein kinase type I-alpha regulatory subunit (PRKAR1A) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat CAMP-dependent protein kinase type I-alpha regulatory subunit (PRKAR1A)

KTE100435-96T 96T
EUR 539
  • cAMP is a signaling molecule important for a variety of cellular functions. cAMP exerts its effects by activating the cAMP-dependent protein kinase A (PKA), which transduces the signal through phosphorylation of different target proteins. Four differ
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat CAMP-dependent protein kinase type I-alpha regulatory subunit (PRKAR1A) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human CAMP-dependent protein kinase type I-alpha regulatory subunit (PRKAR1A)

KTE61152-48T 48T
EUR 332
  • cAMP is a signaling molecule important for a variety of cellular functions. cAMP exerts its effects by activating the cAMP-dependent protein kinase A (PKA), which transduces the signal through phosphorylation of different target proteins. Four differ
  • Show more
Description: Quantitative sandwich ELISA for measuring Human CAMP-dependent protein kinase type I-alpha regulatory subunit (PRKAR1A) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human CAMP-dependent protein kinase type I-alpha regulatory subunit (PRKAR1A)

KTE61152-5platesof96wells 5 plates of 96 wells
EUR 2115
  • cAMP is a signaling molecule important for a variety of cellular functions. cAMP exerts its effects by activating the cAMP-dependent protein kinase A (PKA), which transduces the signal through phosphorylation of different target proteins. Four differ
  • Show more
Description: Quantitative sandwich ELISA for measuring Human CAMP-dependent protein kinase type I-alpha regulatory subunit (PRKAR1A) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human CAMP-dependent protein kinase type I-alpha regulatory subunit (PRKAR1A)

KTE61152-96T 96T
EUR 539
  • cAMP is a signaling molecule important for a variety of cellular functions. cAMP exerts its effects by activating the cAMP-dependent protein kinase A (PKA), which transduces the signal through phosphorylation of different target proteins. Four differ
  • Show more
Description: Quantitative sandwich ELISA for measuring Human CAMP-dependent protein kinase type I-alpha regulatory subunit (PRKAR1A) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/micca.org/public_html/wp-content/plugins/gentaur-linking/vendor_prefixed/pwpf/src/View/View.php on line 66
It is concluded that AMF + Trichoderma + PGPR is the only mixture to advertise resistance to TFCRR in tomato. The up-regulation and down-regulation of metabolites regulated by symbiotic microbial genes could also be an essential mechanism by which root symbiotic microorganisms promote plant progress, enhance yield, and improve illness resistance.

Leave a Reply

Your email address will not be published. Required fields are marked *