Towards the development of defined microbial therapeutics

September 30, 2021 0 Comments


Notice: Trying to access array offset on value of type bool in /home/fwsoeulh/domains/micca.org/public_html/wp-content/plugins/gentaur-linking/app/Libs/LSPDRequest.php on line 194

Notice: Trying to access array offset on value of type bool in /home/fwsoeulh/domains/micca.org/public_html/wp-content/plugins/gentaur-linking/app/Libs/LSPDRequest.php on line 208

Notice: Trying to access array offset on value of type bool in /home/fwsoeulh/domains/micca.org/public_html/wp-content/plugins/gentaur-linking/app/Libs/LSPDRequest.php on line 229

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/micca.org/public_html/wp-content/plugins/gentaur-linking/vendor_prefixed/pwpf/src/View/View.php on line 103

The assortment of microorganisms residing in the mammalian gastrointestinal tract, termed the intestine microbiota, has been proven to have profound impacts on host well being and more and more is considered a viable therapeutic goal. Clinical research of fecal microbiota transplantation (FMT) have demonstrated potential efficacy of microbiota-based therapies for ailments together with Clostridioides difficile infections, inflammatory bowel illness, graft-versus-host illness and most cancers.
However, the lack of understanding of the energetic components and potential dangers of such therapies pose challenges for scientific utility. Meanwhile, efforts are being made to establish effector microbes instantly related to a given phenotype, to ascertain causality and to plan well-characterized microbial therapeutics for scientific use. Strategies primarily based on defined microbial elements will seemingly improve the potential of microbiota-targeted therapies.

Stable isotope fractionation reveals comparable atomic stage controls throughout cardio and anaerobic microbial Hg transformation pathways

Mercury (Hg) is a world pollutant and potent neurotoxin that bioaccumulates in meals webs as monomethylmercury (MeHg). The manufacturing of MeHg is pushed by anaerobic and Hg redox biking pathways similar to Hg discount, which management the availability of Hg to methylators. Anaerobes play an vital position in Hg discount in methylation hotspots, but their contributions stay underappreciated attributable to how difficult these pathways are to review in the absence of devoted genetic targets and low ranges of Hg0 in anoxic environments.
In this examine we used Hg secure isotope fractionation to discover Hg discount throughout anoxygenic photosynthesis and fermentation in the mannequin anaerobe Heliobacterium modesticaldum Ice1. We present that cells preferentially cut back lighter Hg isotopes in each metabolisms resulting in mass-dependent fractionation, however mass-independent fractionation generally induced by UV-visible mild is absent.
Due to variability related to replicated experiments, we couldn’t discern whether or not devoted physiological processes drive Hg discount throughout photosynthesis and fermentation. However, we show that fractionation is affected by the interaction between pathways controlling Hg recruitment, accessibility, and availability alongside metabolic redox reactions.
The mixed contributions of these processes result in isotopic enrichment throughout anoxygenic photosynthesis that’s in between the values reported for anaerobic respiratory microbial Hg discount and abiotic photoreduction. Isotope enrichment throughout fermentation is nearer to what has been noticed in cardio micro organism that cut back Hg by devoted cleansing pathways. Our work means that comparable controls seemingly underpin numerous microbe-mediated Hg transformations that have an effect on Hg’s destiny in oxic and anoxic habitats.
 IMPORTANCE Anaerobic and photosynthetic micro organism that cut back mercury have an effect on mercury supply to microbes in methylation websites that drive bioaccumulation in meals webs. Anaerobic mercury discount pathways stay underappreciated in the present view of the international mercury cycle as a result of they’re difficult to review, bearing no devoted genetic targets to ascertain physiological mechanisms. In this examine we used secure isotopes to characterize the physiological processes that management mercury discount throughout photosynthesis and fermentation in the mannequin anaerobe Heliobacterium modesticaldum Ice1.
The sensitivity of isotope analyses highlighted the delicate contribution of mercury uptake in the direction of the isotope signature related to anaerobic mercury discount. When thought-about alongside the isotope signatures related to microbial pathways for which genetic determinants have been recognized, our findings underscore the slim vary of isotope enrichment that’s attribute of microbial mercury transformations. This means that there exist widespread atomic-level controls for organic mercury transformations throughout a broad vary of geochemical circumstances.

Biodegradation and metabolism of tetrabromobisphenol A in microbial gas cell: Behaviors, dynamic pathway and the molecular ecological mechanism

Tetrabromobisphenol A (TBBPA) has aroused widespread air pollution in industrial wastewater. Microbial gas cell (MFC) was proved highly effective in organics degradation and simultaneous useful resource restoration throughout wastewater therapy. However, the TBBPA biotransformation potential, pathway and the associated molecular mechanism stay poorly understood.
Towards the development of defined microbial therapeutics
In this examine, the enhanced degradation and cleansing efficiency of TBBPA in MFC anode was confirmed, evidenced by the shorter degradation interval (2.three occasions shorter) and fewer technology of bisphenol A. UPLC-QTOF-MS evaluation verified TBBPA metabolism went by reductive debromination, hydrolytic debromination, oxidative ring cleavage and o-methylation. Accompanied with these biochemical processes, the metabolites underwent dynamic adjustments.
The distinctly decreased abundance and fewer interactions with different purposeful genera for the potential reductive dehalogenators (Pseudomonas, and so on.) probably led to the suppressed reductive debromination (5.1%) in the closed bioanode. Otherwise, the extra considerable potential perform micro organism with extra collaborated interrelations, together with hydrolytic dehalogenators (Acinetobacter, and so on.), aromatics degrading micro organism (Geobacter, Holophaga, and so on.) and electroactive micro organism (Geobacter, Desulfovibrio, and so on.) made nice sense to the enhanced hydrolytic debromination and cleansing of TBBPA. This examine revealed that MFC anode was helpful to TBBPA degradation and supplied theoretical help for the decomposition and transformation of micro-pollutants in the municipal sewage therapy coupled with MFC course of.

Humic acid removing and microbial group perform in membrane bioreactor

A membrane bioreactor with humic acid substrate (MBR-H) was operated to research natural removing and membrane efficiency. Approximately, 60% of chemical oxygen demand removing was noticed in MBR-H. The biosorption capability reached to the most worth of 29.2 mg g-1 in the experiments with numerous activated sludge concentrations and the quantity adsorbed on the newly produced microbes was restricted.
To perceive key capabilities of microorganisms in the biodegradation of humic acid, the microbial group was examined. The dominant phylum was modified from Actinobacteria at the uncooked sludge to Proteobacteria at the MBR-H. Especially, nice will increase of β-, γ-, and δ-Proteobacteria in the MBR-H indicated that these class of Proteobacteria performed a significant position in humic acid removing. Investigation at the genus stage confirmed enrichment of Stenotrophobacter in the MBR-H, which indicated the presence of metabolites in the proposed humic substance degradation pathway.

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/micca.org/public_html/wp-content/plugins/gentaur-linking/vendor_prefixed/pwpf/src/View/View.php on line 64

CREB1 Antibody

1-CSB-PA005947GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CREB1. Recognizes CREB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

CREB1 Antibody

1-CSB-PA005947HA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CREB1. Recognizes CREB1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

CREB1 Antibody

CSB-PA005947KA01HU-
EUR 335
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against CREB1. Recognizes CREB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

CREB1 Antibody

CSB-PA005947KA01HU-100ul 100ul
EUR 389
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against CREB1. Recognizes CREB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

CREB1 Antibody

1-CSB-PA001781
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CREB1. Recognizes CREB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

CREB1 Antibody

1-CSB-PA001782
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CREB1. Recognizes CREB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/5000

CREB1 Antibody

1-CSB-PA000376
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against CREB1. Recognizes CREB1 from Human. This antibody is Unconjugated. Tested in the following application: WB;WB:1:1000-2000

CREB1 Antibody

1-CSB-PA923713
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CREB1. Recognizes CREB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:15-1:50

CREB1 Antibody

1-CSB-PA927573
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CREB1. Recognizes CREB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

CREB1 Antibody

1-CSB-PA205203
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CREB1. Recognizes CREB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

CREB1 Antibody

BF0153 200ul
EUR 376
Description: CREB1 antibody detects endogenous levels of total CREB1.

CREB1 Antibody

1-CSB-PA007252
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CREB1. Recognizes CREB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/40000

CREB1 Antibody

1-CSB-PA007258
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CREB1. Recognizes CREB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000

CREB1 Antibody

ABD6323 100 ug
EUR 438

CREB1 antibody

PAab09947 100 ug
EUR 386

CREB1 antibody (Ser133)

70R-14955 100 ul
EUR 392
Description: Rabbit polyclonal CREB1 antibody (Ser133)

CREB1 Conjugated Antibody

C42701 100ul
EUR 397

CREB1 Conjugated Antibody

C32215 100ul
EUR 397

CREB1 Polyclonal Antibody

A52845 100 µg
EUR 570.55
Description: Ask the seller for details

Anti-CREB1 Antibody

A1754-100
EUR 479

CREB1 (pS129) Antibody

20-abx000380
  • EUR 495.00
  • EUR 704.00
  • EUR 356.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

CREB1 (pS133) Antibody

20-abx000381
  • EUR 495.00
  • EUR 704.00
  • EUR 356.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

CREB1 (pS142) Antibody

20-abx000382
  • EUR 495.00
  • EUR 704.00
  • EUR 356.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

anti- CREB1 antibody

FNab09947 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • IHC: 1:20-1:200
  • IF: 1:10-1:100
  • Immunogen: cAMP responsive element binding protein 1
  • Uniprot ID: P16220
  • Gene ID: 1385
  • Research Area: Signal Transduction, Metabolism, Cardiovascular, Immunology, Cancer, Developm
  • Show more
Description: Antibody raised against CREB1

anti- CREB1 antibody

FNab01961 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:3000
  • IP: 1:500-1:1000
  • IHC: 1:20-1:200
  • IF: 1:10-1:100
  • Immunogen: cAMP responsive element binding protein 1
  • Uniprot ID: P16220
  • Gene ID: 1385
  • Research Area: Signal Transduction, Metabolism, Cardiovascular, Immunology
  • Show more
Description: Antibody raised against CREB1

anti- CREB1 antibody

LSMab09947 100 ug
EUR 386

Anti-CREB1 antibody

PAab01961 100 ug
EUR 386

Anti-CREB1 antibody

STJ112722 100 µl
EUR 393
Description: This gene encodes a transcription factor that is a member of the leucine zipper family of DNA binding proteins. This protein binds as a homodimer to the cAMP-responsive element, an octameric palindrome. The protein is phosphorylated by several protein kinases, and induces transcription of genes in response to hormonal stimulation of the cAMP pathway. Alternate splicing of this gene results in several transcript variants encoding different isoforms.

Anti-CREB1 antibody

STJ112927 100 µl
EUR 277
Description: This gene encodes a transcription factor that is a member of the leucine zipper family of DNA binding proteins. This protein binds as a homodimer to the cAMP-responsive element, an octameric palindrome. The protein is phosphorylated by several protein kinases, and induces transcription of genes in response to hormonal stimulation of the cAMP pathway. Alternate splicing of this gene results in several transcript variants encoding different isoforms.

Anti-CREB1 antibody

STJ113697 100 µl
EUR 277
Description: This gene encodes a transcription factor that is a member of the leucine zipper family of DNA binding proteins. This protein binds as a homodimer to the cAMP-responsive element, an octameric palindrome. The protein is phosphorylated by several protein kinases, and induces transcription of genes in response to hormonal stimulation of the cAMP pathway. Alternate splicing of this gene results in several transcript variants encoding different isoforms.

Anti-CREB1 antibody

STJ113894 100 µl
EUR 277
Description: This gene encodes a transcription factor that is a member of the leucine zipper family of DNA binding proteins. This protein binds as a homodimer to the cAMP-responsive element, an octameric palindrome. The protein is phosphorylated by several protein kinases, and induces transcription of genes in response to hormonal stimulation of the cAMP pathway. Alternate splicing of this gene results in several transcript variants encoding different isoforms.

Anti-CREB1 antibody

STJ114197 100 µl
EUR 277
Description: This gene encodes a transcription factor that is a member of the leucine zipper family of DNA binding proteins. This protein binds as a homodimer to the cAMP-responsive element, an octameric palindrome. The protein is phosphorylated by several protein kinases, and induces transcription of genes in response to hormonal stimulation of the cAMP pathway. Alternate splicing of this gene results in several transcript variants encoding different isoforms.

Anti-CREB1 antibody

STJ116179 100 µl
EUR 277
Description: This gene encodes a transcription factor that is a member of the leucine zipper family of DNA binding proteins. This protein binds as a homodimer to the cAMP-responsive element, an octameric palindrome. The protein is phosphorylated by several protein kinases, and induces transcription of genes in response to hormonal stimulation of the cAMP pathway. Alternate splicing of this gene results in several transcript variants encoding different isoforms.

Creb1/ Rat Creb1 ELISA Kit

ELI-04353r 96 Tests
EUR 886

CREB1 siRNA

20-abx901247
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CREB1 siRNA

20-abx912761
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CREB1 siRNA

20-abx912762
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CREB1 Antibody, HRP conjugated

1-CSB-PA005947HB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CREB1. Recognizes CREB1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CREB1 Antibody, FITC conjugated

1-CSB-PA005947HC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CREB1. Recognizes CREB1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CREB1 Antibody, Biotin conjugated

1-CSB-PA005947HD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CREB1. Recognizes CREB1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Phospho-CREB1 (S142) Antibody

1-CSB-PA000725
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-CREB1 (S142). Recognizes Phospho-CREB1 (S142) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/40000

Phospho-CREB1 (S133) Antibody

1-CSB-PA000505
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-CREB1 (S133). Recognizes Phospho-CREB1 (S133) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IP, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IP:2-5ug/mglysate.ELISA:1/10000

Phospho-CREB1 (Thr100) Antibody

CSB-PA055839-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
  • Show more
Description: A polyclonal antibody against Phospho-CREB1 (Thr100). Recognizes Phospho-CREB1 (Thr100) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

Phospho-CREB1 (Thr100) Antibody

CSB-PA055839-100ul 100ul
EUR 362
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
  • Show more
Description: A polyclonal antibody against Phospho-CREB1 (Thr100). Recognizes Phospho-CREB1 (Thr100) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

Phospho-CREB1 (Ser129) Antibody

CSB-PA122114-
EUR 335
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates.
  • Show more
Description: A polyclonal antibody against Phospho-CREB1 (Ser129). Recognizes Phospho-CREB1 (Ser129) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:1000, IHC:1:50-1:100

Phospho-CREB1 (Ser129) Antibody

CSB-PA122114-100ul 100ul
EUR 362
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates.
  • Show more
Description: A polyclonal antibody against Phospho-CREB1 (Ser129). Recognizes Phospho-CREB1 (Ser129) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:1000, IHC:1:50-1:100

Phospho-CREB1 (Ser133) Antibody

CSB-PA935267-
EUR 335
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates.
  • Show more
Description: A polyclonal antibody against Phospho-CREB1 (Ser133). Recognizes Phospho-CREB1 (Ser133) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:1000, IHC:1:50-1:100

Phospho-CREB1 (Ser133) Antibody

CSB-PA935267-100ul 100ul
EUR 362
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates.
  • Show more
Description: A polyclonal antibody against Phospho-CREB1 (Ser133). Recognizes Phospho-CREB1 (Ser133) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:1000, IHC:1:50-1:100

CREB1 (Ab-129) Antibody

CSB-PA994499-
EUR 335
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against CREB1 (Ab-129). Recognizes CREB1 (Ab-129) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:1000, IHC:1:50-1:200

CREB1 (Ab-129) Antibody

CSB-PA994499-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against CREB1 (Ab-129). Recognizes CREB1 (Ab-129) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:1000, IHC:1:50-1:200

Polyclonal CREB1 / CREB Antibody

APR02988G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CREB1 / CREB . This antibody is tested and proven to work in the following applications:

Polyclonal CREB1 Antibody (Center)

APR03604G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CREB1 (Center). This antibody is tested and proven to work in the following applications:

Phospho-CREB1 (Ser142) Antibody

CSB-PA275971-
EUR 335
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates.
  • Show more
Description: A polyclonal antibody against Phospho-CREB1 (Ser142). Recognizes Phospho-CREB1 (Ser142) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:1000, IHC:1:50-1:100

Phospho-CREB1 (Ser142) Antibody

CSB-PA275971-100ul 100ul
EUR 362
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates.
  • Show more
Description: A polyclonal antibody against Phospho-CREB1 (Ser142). Recognizes Phospho-CREB1 (Ser142) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:1000, IHC:1:50-1:100

CREB1 (Ab-133) Antibody

CSB-PA202670-
EUR 335
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against CREB1 (Ab-133). Recognizes CREB1 (Ab-133) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:1000, IHC:1:50-1:200

CREB1 (Ab-133) Antibody

CSB-PA202670-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against CREB1 (Ab-133). Recognizes CREB1 (Ab-133) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:1000, IHC:1:50-1:200

CREB1 (Ab-142) Antibody

CSB-PA247962-
EUR 335
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against CREB1 (Ab-142). Recognizes CREB1 (Ab-142) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;IHC:1:50-1:100

CREB1 (Ab-142) Antibody

CSB-PA247962-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against CREB1 (Ab-142). Recognizes CREB1 (Ab-142) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;IHC:1:50-1:100

Phospho-CREB1 (S129) Antibody

1-CSB-PA007246
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-CREB1 (S129). Recognizes Phospho-CREB1 (S129) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, IF, ELISA;IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/40000

Phospho-CREB1 (S121) Antibody

1-CSB-PA007248
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-CREB1 (S121). Recognizes Phospho-CREB1 (S121) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/5000

Phospho-CREB1 (T100) Antibody

1-CSB-PA007251
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-CREB1 (T100). Recognizes Phospho-CREB1 (T100) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

Phospho- CREB1(S133) antibody

PAab09948 100 ug
EUR 386

Anti-CREB/CREB1 Antibody

PB9100 100ug/vial
EUR 294

Polyclonal CREB1 / CREB Antibody (Ser133)

APR02401G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CREB1 / CREB (Ser133). This antibody is tested and proven to work in the following applications:

Monoclonal CREB1 Antibody, Clone: 1335CT115.203.189

AMM02443G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human CREB1. The antibodies are raised in Mouse and are from clone 1335CT115.203.189. This antibody is applicable in WB, E

Monoclonal CREB1 Antibody, Clone: 5G3

AMM02835G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human CREB1. The antibodies are raised in Mouse and are from clone 5G3. This antibody is applicable in WB and IHC, ICC, E

CREB1 Polyclonal Antibody, Biotin Conjugated

A52846 100 µg
EUR 570.55
Description: The best epigenetics products

CREB1 Polyclonal Antibody, HRP Conjugated

A52847 100 µg
EUR 570.55
Description: kits suitable for this type of research

CREB1 Polyclonal Antibody, FITC Conjugated

A52848 100 µg
EUR 570.55
Description: fast delivery possible

anti- Phospho- CREB1(S133) antibody

FNab09948 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IF: 1:50 - 1:200
  • Immunogen: Phospho-CREB1-S133
  • Uniprot ID: P16220
  • Gene ID: 1385
  • Research Area: Signal Transduction, Metabolism, Cardiovascular, Immunology, Cancer, Developmental biology, Neuroscience
Description: Antibody raised against Phospho- CREB1(S133)

anti- Phospho- CREB1(S133) antibody

LSMab09948 100 ug
EUR 386

Anti-Phospho-CREB1-S129 antibody

STJ11101038 100 µl
EUR 393
Description: This gene encodes a transcription factor that is a member of the leucine zipper family of DNA binding proteins. This protein binds as a homodimer to the cAMP-responsive element, an octameric palindrome. The protein is phosphorylated by several protein kinases, and induces transcription of genes in response to hormonal stimulation of the cAMP pathway. Alternate splicing of this gene results in several transcript variants encoding different isoforms.

Anti-Phospho-CREB1-(S133) antibody

STJ22076 100 µl
EUR 393
Description: This gene encodes a transcription factor that is a member of the leucine zipper family of DNA binding proteins. This protein binds as a homodimer to the cAMP-responsive element, an octameric palindrome. The protein is phosphorylated by several protein kinases, and induces transcription of genes in response to hormonal stimulation of the cAMP pathway. Alternate splicing of this gene results in several transcript variants encoding different isoforms.

Anti-Phospho-CREB1-(S133) antibody

STJ22079 100 µl
EUR 393
Description: This gene encodes a transcription factor that is a member of the leucine zipper family of DNA binding proteins. This protein binds as a homodimer to the cAMP-responsive element, an octameric palindrome. The protein is phosphorylated by several protein kinases, and induces transcription of genes in response to hormonal stimulation of the cAMP pathway. Alternate splicing of this gene results in several transcript variants encoding different isoforms.

Anti-Phospho-CREB1-(S142) antibody

STJ22080 100 µl
EUR 393
Description: This gene encodes a transcription factor that is a member of the leucine zipper family of DNA binding proteins. This protein binds as a homodimer to the cAMP-responsive element, an octameric palindrome. The protein is phosphorylated by several protein kinases, and induces transcription of genes in response to hormonal stimulation of the cAMP pathway. Alternate splicing of this gene results in several transcript variants encoding different isoforms.

Anti-CREB1 (aa96-109) antibody

STJ73024 100 µg
EUR 359

CREB1 Rabbit mAb

A10826-100ul 100 ul
EUR 384

CREB1 Rabbit mAb

A10826-200ul 200 ul
EUR 554

CREB1 Rabbit mAb

A10826-20ul 20 ul
EUR 221

CREB1 Rabbit mAb

A10826-50ul 50 ul
EUR 265

CREB1 Rabbit pAb

A11063-100ul 100 ul
EUR 308

CREB1 Rabbit pAb

A11063-200ul 200 ul
EUR 459

CREB1 Rabbit pAb

A11063-20ul 20 ul
EUR 183

CREB1 Rabbit pAb

A11063-50ul 50 ul
EUR 223

CREB1 Rabbit pAb

A11064-100ul 100 ul
EUR 308

CREB1 Rabbit pAb

A11064-200ul 200 ul
EUR 459

CREB1 Rabbit pAb

A11064-20ul 20 ul
EUR 183

CREB1 Rabbit pAb

A11064-50ul 50 ul
EUR 223

CREB1 Rabbit pAb

A11989-100ul 100 ul
EUR 308

CREB1 Rabbit pAb

A11989-200ul 200 ul
EUR 459

CREB1 Rabbit pAb

A11989-20ul 20 ul
EUR 183

CREB1 Rabbit pAb

A11989-50ul 50 ul
EUR 223

CREB1 Rabbit pAb

A12311-100ul 100 ul
EUR 308

CREB1 Rabbit pAb

A12311-200ul 200 ul
EUR 459

CREB1 Rabbit pAb

A12311-20ul 20 ul
EUR 183

CREB1 Rabbit pAb

A12311-50ul 50 ul
EUR 223

CREB1 Blocking Peptide

BF0153-BP 1mg
EUR 195

CREB1 cloning plasmid

CSB-CL005947HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1026
  • Sequence: atgaccatggaatctggagccgagaaccagcagagtggagatgcagctgtaacagaagctgaaaaccaacaaatgacagttcaagcccagccacagattgccacattagcccaggtatctatgccagcagctcatgcaacatcatctgctcccaccgtaactctagtacagctgc
  • Show more
Description: A cloning plasmid for the CREB1 gene.

CREB1 Rabbit pAb

A2431-100ul 100 ul
EUR 308

CREB1 Rabbit pAb

A2431-200ul 200 ul
EUR 459

CREB1 Rabbit pAb

A2431-20ul 20 ul
EUR 183

CREB1 Rabbit pAb

A2431-50ul 50 ul
EUR 223

anti-CREB1 (5G3)

LF-MA30563 100 ul
EUR 527
Description: Mouse Monoclonal to CREB1

Recombinant Human CREB1

P0471 100ug
EUR 522.36
  • Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose
  • Reconstitution: Sterile distilled water
  • Purity: Greater than 95% by SDS-PAGE gel analyses
  • Uniprot ID: P16220
Description: Recombinant Human protein for CREB1

pBluescriptR-CREB1 Plasmid

PVTB00586 2 ug
EUR 356

pCMV-SPORT6-CREB1

PVT12881 2 ug
EUR 391

Polyclonal CREB1 antibody - N-terminal region

APR11043G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CREB1 - N-terminal region. This antibody is tested and proven to work in the following applications:

Human CREB1 ELISA Kit

ELA-E1318h 96 Tests
EUR 824

Bovine CREB1 ELISA KIT

ELI-04352b 96 Tests
EUR 928

Mouse Creb1 ELISA KIT

ELI-04354m 96 Tests
EUR 865

Human CREB1 ELISA KIT

ELI-04355h 96 Tests
EUR 824

CREB1 ELISA KIT|Human

EF008835 96 Tests
EUR 689

Rat CREB1 shRNA Plasmid

20-abx986621
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse CREB1 shRNA Plasmid

20-abx969804
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human CREB1 shRNA Plasmid

20-abx950971
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CREB1 Recombinant Protein (Human)

RP007972 100 ug Ask for price

CREB1 Recombinant Protein (Rat)

RP196235 100 ug Ask for price

CREB1 Recombinant Protein (Rat)

RP196238 100 ug Ask for price

CREB1 Recombinant Protein (Mouse)

RP125921 100 ug Ask for price

CREB1 Recombinant Protein (Mouse)

RP125924 100 ug Ask for price

CREB1 Recombinant Protein (Mouse)

RP125927 100 ug Ask for price

Polyclonal CREB1 (aa96-109) Antibody (internal region)

APG00910G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human CREB1 (aa96-109) (internal region). This antibody is tested and proven to work in the following applications:

Phospho-CREB1-S133 Antibody Kit (AP0019 & A11989)

RK04087 50 ul
EUR 344

Human cAMP-responsive element modulator isoform 27 (CREB1) control (CREB1- phospho) peptide

AB-23263-P 100ug
EUR 164

Phospho-CREB1-S129 Rabbit pAb

AP0903-100ul 100 ul
EUR 384

Phospho-CREB1-S129 Rabbit pAb

AP0903-200ul 200 ul
EUR 554

Phospho-CREB1-S129 Rabbit pAb

AP0903-20ul 20 ul
EUR 183

Phospho-CREB1-S129 Rabbit pAb

AP0903-50ul 50 ul
EUR 265

Phospho-CREB1-S133 Rabbit pAb

AP0019-100ul 100 ul
EUR 384

Phospho-CREB1-S133 Rabbit pAb

AP0019-200ul 200 ul
EUR 554

Phospho-CREB1-S133 Rabbit pAb

AP0019-20ul 20 ul
EUR 183

Phospho-CREB1-S133 Rabbit pAb

AP0019-50ul 50 ul
EUR 265

Phospho-CREB1-S133 Rabbit pAb

AP0333-100ul 100 ul
EUR 384

Phospho-CREB1-S133 Rabbit pAb

AP0333-200ul 200 ul
EUR 554

Phospho-CREB1-S133 Rabbit pAb

AP0333-20ul 20 ul
EUR 183

Phospho-CREB1-S133 Rabbit pAb

AP0333-50ul 50 ul
EUR 265

Phospho-CREB1-S142 Rabbit pAb

AP0334-100ul 100 ul
EUR 384

Phospho-CREB1-S142 Rabbit pAb

AP0334-200ul 200 ul
EUR 554

Phospho-CREB1-S142 Rabbit pAb

AP0334-20ul 20 ul Ask for price

Phospho-CREB1-S142 Rabbit pAb

AP0334-50ul 50 ul
EUR 265

Creb1 ORF Vector (Rat) (pORF)

ORF065413 1.0 ug DNA
EUR 506

Creb1 ORF Vector (Rat) (pORF)

ORF065414 1.0 ug DNA
EUR 506

h CREB1 inducible lentiviral particles

LVP145 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, CREB1, is fully sequence verified and matched to NCBI accession ID: NM_004379

CREB1 ORF Vector (Human) (pORF)

ORF002658 1.0 ug DNA
EUR 95

Creb1 ORF Vector (Mouse) (pORF)

ORF041975 1.0 ug DNA
EUR 506

Creb1 ORF Vector (Mouse) (pORF)

ORF041976 1.0 ug DNA
EUR 506

Creb1 ORF Vector (Mouse) (pORF)

ORF041977 1.0 ug DNA
EUR 506

CREB1 ELISA Kit (Bovine) (OKEH07914)

OKEH07914 96 Wells
EUR 1092
Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.8pg/mL

CREB1 ELISA Kit (Human) (OKEH04003)

OKEH04003 96 Wells
EUR 479
Description: Description of target: This gene encodes a transcription factor that is a member of the leucine zipper family of DNA binding proteins. This protein binds as a homodimer to the cAMP-responsive element, an octameric palindrome. The protein is phosphorylated by several protein kinases, and induces transcription of genes in response to hormonal stimulation of the cAMP pathway. Alternate splicing of this gene results in several transcript variants encoding different isoforms.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.98 ng/mL

Rabbit Anti-CREB1 monoclonal antibody, clone TB15-15

DCABH-6198 100 ul
EUR 777

cAMP Responsive Element Binding Protein 1 (CREB1) Antibody

abx026401-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

cAMP Responsive Element Binding Protein 1 (CREB1) Antibody

abx026401-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

CAMP Responsive Element Binding Protein 1 (CREB1) Antibody

20-abx214261
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

CAMP Responsive Element Binding Protein 1 (CREB1) Antibody

20-abx213708
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

cAMP Responsive Element Binding Protein 1 (CREB1) Antibody

20-abx111342
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

cAMP Responsive Element Binding Protein 1 (CREB1) Antibody

abx117057-100ug 100 ug
EUR 467
  • Shipped within 5-10 working days.

cAMP Responsive Element Binding Protein 1 (CREB1) Antibody

20-abx125321
  • EUR 495.00
  • EUR 704.00
  • EUR 356.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

cAMP Responsive Element Binding Protein 1 (CREB1) Antibody

20-abx125715
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

cAMP Responsive Element Binding Protein 1 (CREB1) Antibody

20-abx125716
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

cAMP Responsive Element Binding Protein 1 (CREB1) Antibody

abx037835-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

cAMP Responsive Element Binding Protein 1 (CREB1) Antibody

abx037836-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

cAMP Responsive Element Binding Protein 1 (CREB1) Antibody

abx038333-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

cAMP Responsive Element Binding Protein 1 (CREB1) Antibody

abx038461-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

cAMP Responsive Element Binding Protein 1 (CREB1) Antibody

20-abx136148
  • EUR 495.00
  • EUR 356.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

cAMP Responsive Element Binding Protein 1 (CREB1) Antibody

20-abx109689
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

CAMP Responsive Element Binding Protein 1 (CREB1) Antibody

20-abx159458
  • EUR 272.00
  • EUR 230.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Notice: Trying to access array offset on value of type null in /home/fwsoeulh/domains/micca.org/public_html/wp-content/plugins/gentaur-linking/vendor_prefixed/pwpf/src/View/View.php on line 66
In addition, the micro organism producing extracellular polymeric substances had been elevated in the MBR-H. Substantial variation of microbial group perform was occurred in the MBR to degrade humic acid. Operational parameters in MBRs is likely to be sought to keep up water permeability and to acquire preferable situation to evolution of microbial consortia for degradation of the refractory natural matter.

Leave a Reply

Your email address will not be published. Required fields are marked *